/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Lehninger Principles of Biochemistry Chapter 27 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 12

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

Problem 13

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

Problem 14

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the \(\beta\)-globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

Problem 15

Proofreading by Aminoacyl-tRNA Synthetases The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

Problem 16

Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. a. What features of tRNA \(^{\text {Ala }}\) does Ala-tRNA synthetase recognize? b. Describe the consequences of a \(\mathrm{C} \rightarrow \mathrm{G}\) mutation in the third position of the anticodon of \(\mathrm{tRNA}^{\mathrm{Ala}}\). c. What other kinds of mutations might have similar effects? d. Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.)

Problem 17

Rate of Protein Synthesis A bacterial ribosome can synthesize about 20 peptide bonds per minute. If the average bacterial protein is approximately 260 amino acid residues long, how many proteins can the ribosomes in an \(E\). coli cell synthesize in 20 minutes if all ribosomes are functioning at maximum rates?

Problem 18

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Problem 20

Bacterial Protein Export Bacteria mostly use the system shown in Eig \(27-44\) to export proteins out of the cell. SecB, one of the chaperone proteins found only in gram-negative bacteria, delivers a newly translated polypeptide to the SecA ATPase on the interior side of the membrane. SecA pushes the exported protein through a membrane pore formed by the SecYEG complex. The SecYEG complex is homologous to the Sec61 complex in eukaryotes. Which component of this bacterial protein export system would be the most attractive target for antibiotic development? Explain.

Problem 22

Requirements for Protein Translocation across a Membrane The secreted bacterial protein OmpA has a precursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If you denature purified ProOmpA with \(8 \mathrm{M}\) urea and then remove the urea (such as by running the protein solution rapidly through a gel filtration column), the protein can translocate across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if you first incubate ProOmpA for a few hours in the absence of urea. Furthermore, ProOmpA maintains its capacity for translocation for an extended period if you first incubate it in the presence of another bacterial protein called trigger factor. Describe the probable function of trigger factor.

Problem 23

Protein-Coding Capacity of a Viral DNA The \(5,386 \mathrm{bp}\) genome of bacteriophage \(\phi \times 174\) includes genes for 10 proteins, designated A to \(\mathrm{K}\) (omitting "I"), with sizes given in the table. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the \(\phi \mathrm{X} 174\) genome with its protein-coding capacity? \begin{tabular}{ccc} Protein & Number of amino acid residues & Protein & Number of amino acid residues \\ \hline \end{tabular} \begin{array}{llll} \text { A } & 455 & 427 \\ \text { B } & 120 & \text { F } & 175 \\ \text { C } & 86 & \text { H } & 328 \\ \text { D } & 152 & \text { J } & 38 \\ \text { E } & 91 & \text { K } & 56 \\ \hline \end{array}

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks