/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Lehninger Principles of Biochemistry Chapter 8 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 1

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Problem 2

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCG CAATATTTCTCAAAATATTGCGC \(\left(3^{\prime}\right)\). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the doublestranded DNA have the potential to form any alternative structures?

Problem 3

DNA of the Human Body If completely unraveled, all of a human's DNA would be able to reach a distance of nearly \(3.2 \times 10^{5} \mathrm{~km}\), the distance from Earth to the moon. Given that each base pair in a DNA helix extends a distance of \(3.4 \AA\), calculate the number of base pairs found within the entirety of a human's DNA.

Problem 5

Distinction between DNA Structure and RNA Structure Secondary structures called hairpins may form at palindromic sequences in single strands of either RNA or DNA. The fully base-paired portions of hairpins form helices. How do RNA hairpins differ from DNA hairpins?

Problem 6

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G} \equiv \mathrm{C}\), not \(\mathrm{A}-\mathrm{T}\), base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

Problem 7

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACT CACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is constructed, will its melting temperature be higher or lower?

Problem 10

Nucleic Acid Identity Explain how RNA nucleotides differ from DNA nucleotides.

Problem 11

Nucleic Acid Structure Explain why the absorption of UV light by double- stranded DNA increases (the hyperchromic effect) when the DNA is denatured.

Problem 15

Genomic Sequencing In large-genome sequencing projects, the initial data usually reveal gaps between contigs where no sequence information has been obtained. To close the gaps, DNA primers complementary to the \(5^{\prime}\)-ending strand at the end of each contig are especially useful. Explain how researchers could use these primers to close the gaps between contigs.

Problem 16

Next-Generation Sequencing In reversible terminator sequencing, how would the sequencing process be affected if the \(3^{\prime}\)-end-blocking group of each nucleotide were replaced with the \(3^{\prime}\)-H present in the dideoxynucleotides used in Sanger sequencing?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks