/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 14 Basis of the Sickle Cell Mutatio... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the \(\beta\)-globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

Short Answer

Expert verified
Glu (GAG) changed to Val (GUG) by a single base mutation.

Step by step solution

01

Identify Codons for Glutamate and Valine

In the standard genetic code, the codons for glutamate (Glu) are GAA and GAG. For valine (Val), the codons are GUU, GUC, GUA, and GUG. Our task is to determine how a mutation in the DNA could change a codon for Glu into a codon for Val.
02

Understand the Mutation Mechanism

Point mutations usually result from a single base change in the DNA sequence. Since the major mutation in sickle cell anemia affects the beta-globin gene, we need to find a base substitution that changes a Glu codon into a Val codon.
03

Determine the Single Base Change

Compare the Glu codons GAA/GAG with the Val codons GUU/GUC/GUA/GUG: - For codon GAA to change into GUU: A->U and A->U, which would require two base changes. - For codon GAA to change into GUA: The second A changes to U (GAA -> GUA), which is a single base change. - For codon GAG to become GUG: The second G becomes U (GAG -> GUG), which is a single base change.
04

Conclusion Based on Mutation

The most likely single base change occurred from codon GAG to GUG, changing a glutamate to a valine at position 6 in the beta-globin chain, which is consistent with a typical point mutation like the sickle cell mutation.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Point Mutation
A point mutation refers to a change that occurs in a single nucleotide base pair within the DNA sequence. This type of mutation is significant because it can alter the codons in the mRNA, potentially changing the final amino acid sequence in a protein.

Point mutations are common types of genetic mutations, and they can have varying effects on the organism depending on their location and the nature of the alteration.
  • Sometimes, the change is silent, meaning that even though the DNA sequence is altered, the same amino acid is produced, causing no noticeable effect.
  • Other times, a point mutation can result in a missense mutation, which is where one amino acid is replaced with another. This is the case with sickle cell anemia.
  • Lastly, it could lead to a nonsense mutation that results in a premature stop codon, truncating the protein.
Understanding point mutations helps in diagnosing and treating genetic disorders. They are a foundational concept in genetics, necessary for comprehending how slight changes can have significant biological impacts.
Glutamate to Valine Substitution
In sickle cell anemia, the most noteworthy change is the substitution of the amino acid glutamate with valine at position 6 of the \(\beta\)-globin chain in hemoglobin.

This substitution takes place due to a point mutation in the DNA sequence of the hemoglobin gene. The normal codon for glutamate is GAG, and the mutation changes this to GUG, the codon for valine.

  • Glutamate (Glu) is a hydrophilic, negatively charged amino acid. This means it interacts well with water and helps in maintaining the solubility of hemoglobin.
  • Valine (Val), on the other hand, is nonpolar and hydrophobic. It doesn't interact as well with water and causes hemoglobin molecules to stick together.
This change in the amino acid's nature leads to the aggregation of hemoglobin, causing red blood cells to take on a sickle-like shape. These sickled cells can't carry oxygen efficiently and can block blood vessels, leading to various health complications commonly associated with sickle cell anemia.
Genetic Code
The genetic code is a set of rules defining how the sequence of nucleotides in DNA encodes the sequence of amino acids in proteins. It's a critical concept for any understanding of genetics and mutation.

Here are some key features of the genetic code:
  • It is universal, meaning that nearly all organisms use the same genetic code.
  • It is redundant, meaning some amino acids are specified by more than one codon. For example, both GAA and GAG code for glutamate.
  • It is unambiguous, as each codon corresponds to a single amino acid only.
  • It includes start codons, like AUG, signaling the start of protein synthesis, and stop codons, which terminate protein synthesis.
In the context of the sickle cell mutation, the understanding of how the genetic code operates allows us to realize how a single nucleotide change from GAG to GUG can substitute glutamate with valine, leading to significant changes in the protein's properties and function.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Requirements for Protein Translocation across a Membrane The secreted bacterial protein OmpA has a precursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If you denature purified ProOmpA with \(8 \mathrm{M}\) urea and then remove the urea (such as by running the protein solution rapidly through a gel filtration column), the protein can translocate across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if you first incubate ProOmpA for a few hours in the absence of urea. Furthermore, ProOmpA maintains its capacity for translocation for an extended period if you first incubate it in the presence of another bacterial protein called trigger factor. Describe the probable function of trigger factor.

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

Protein-Coding Capacity of a Viral DNA The \(5,386 \mathrm{bp}\) genome of bacteriophage \(\phi \times 174\) includes genes for 10 proteins, designated A to \(\mathrm{K}\) (omitting "I"), with sizes given in the table. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the \(\phi \mathrm{X} 174\) genome with its protein-coding capacity? \begin{tabular}{ccc} Protein & Number of amino acid residues & Protein & Number of amino acid residues \\ \hline \end{tabular} \begin{array}{llll} \text { A } & 455 & 427 \\ \text { B } & 120 & \text { F } & 175 \\ \text { C } & 86 & \text { H } & 328 \\ \text { D } & 152 & \text { J } & 38 \\ \text { E } & 91 & \text { K } & 56 \\ \hline \end{array}

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.