/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 23 Protein-Coding Capacity of a Vir... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Protein-Coding Capacity of a Viral DNA The \(5,386 \mathrm{bp}\) genome of bacteriophage \(\phi \times 174\) includes genes for 10 proteins, designated A to \(\mathrm{K}\) (omitting "I"), with sizes given in the table. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the \(\phi \mathrm{X} 174\) genome with its protein-coding capacity? \begin{tabular}{ccc} Protein & Number of amino acid residues & Protein & Number of amino acid residues \\ \hline \end{tabular} \begin{array}{llll} \text { A } & 455 & 427 \\ \text { B } & 120 & \text { F } & 175 \\ \text { C } & 86 & \text { H } & 328 \\ \text { D } & 152 & \text { J } & 38 \\ \text { E } & 91 & \text { K } & 56 \\ \hline \end{array}

Short Answer

Expert verified
The DNA required for encoding is 5,781 base pairs, but the genome is 5,386 base pairs, suggesting coding overlap.

Step by step solution

01

Calculate Total Amino Acid Count

To find the total number of amino acid residues encoded by all the proteins, sum the given number of amino acid residues for each protein. The proteins and their respective numbers of amino acids are:- A: 455- B: 120- C: 86- D: 152- E: 91- F: 427- H: 175- J: 328- K: 38Calculating the total: \[\text{Total amino acids} = 455 + 120 + 86 + 152 + 91 + 427 + 175 + 328 + 38 + 56 = 1927\]
02

Determine DNA Required to Encode Proteins

Each amino acid in a protein is encoded by a codon consisting of 3 nucleotides (or base pairs). Therefore, to determine the amount of DNA required to encode the proteins, multiply the total number of amino acids by 3.\[\text{Total base pairs needed} = 1927 \times 3 = 5781\]
03

Compare DNA Requirement vs Genome Size

The calculated total DNA required to encode 10 proteins with 1927 amino acids is 5781 bp. However, the actual size of the bacteriophage \( \phi \times 174 \) genome is stated to be 5,386 bp. This discrepancy may arise due to overlapping genes, where certain DNA sequences could code for multiple proteins. This allows the virus to maximize its genetic information within a smaller genome size.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Protein-Coding
Protein-coding refers to the process of translating genetic instructions into proteins, fundamental components of all living things. Each protein is made up of smaller units called amino acids. The DNA sequences that carry the instructions for creating proteins are what we call genes. Each gene corresponds to a specific protein, defined by the order of its amino acids.

In the viral DNA of the bacteriophage \(\phi \times 174\), each protein is represented by a series of amino acids. To determine how much DNA is needed to code for these proteins, we need to understand that each amino acid is specified by a codon - a sequence of three nucleotides in the DNA. For example, the protein A is made up of 455 amino acids. So, it needs \(455 \times 3 = 1365\) DNA base pairs. This method applies to all proteins listed in the given viral genome.
Bacteriophage
A bacteriophage is a type of virus that infects bacteria. It's fascinating because of its ability to directly interact with bacterial cells by attaching to their surfaces. Once attached, the bacteriophage injects its DNA into the host, utilizing the host's cellular machinery to reproduce.

The bacteriophage \(\phi \times 174\) carries a genome of 5,386 base pairs. This phage is unique due to its small size but high efficiency in encoding proteins. Despite the compact genome, it can encode proteins essential for its replication and survival by using strategies such as gene overlap and a high proportion of protein-coding DNA.
Genome Size
Genome size is the entire amount of DNA contained within one copy of a genome. In the case of bacteriophage \(\phi \times 174\), the genome size is 5,386 base pairs \((bp)\). While this might seem small compared to many organisms, the phage efficiently uses its minimal genetic material.

Genome size is critical as it determines how much genetic information can be stored. Despite the small size, the phage can encode 10 different proteins, thanks to evolutionary strategies such as overlapping genes. This optimized use of its genetic material allows the phage to economize on resources while still being highly functional.
Amino Acids
Amino acids are the building blocks of proteins. There are 20 different amino acids that can be combined in different sequences to create a vast array of proteins, each with specific functions. Each amino acid sequence is coded within the DNA by a set of three nucleotides, known as a codon.

The exercise reveals that the bacteriophage \(\phi \times 174\) genome encodes proteins that contain a combined total of 1,927 amino acids. Understanding the importance of amino acids helps us appreciate how organisms, even tiny viruses, manage to produce complex molecules essential for life processes.
Overlapping Genes
Overlapping genes are a clever genetic strategy to maximize the information a small genome can carry. In overlapping genes, two sequences of DNA are read in different reading frames or directions to produce distinct proteins.

In viruses like bacteriophage \(\phi \times 174\), this means that one stretch of DNA can provide instructions for multiple proteins. This strategy allows viruses to encode their genetic material efficiently even with limited genome size. Overlapping genes help in economizing the genomic space, allowing the virus to maintain essential functions despite genetic constraints.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

Synthetic mRNAs The genetic code was elucidated through the use of polyribonucleotides synthesized either enzymatically or chemically in the laboratory. Given what we now know about the genetic code, how would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and for a small number of Leu and Ser residues? What other amino acid(s) would be encoded by this polyribonucleotide, but in smaller amounts?

The Genetic Code and Mutation A mutation occasionally arises that converts a codon specifying an amino acid to a stop or nonsense codon. When this occurs in the middle of a gene, the resulting protein is truncated and often inactive. If the protein is essential, cell death can result. Which of these secondary mutations might restore some or all of the protein function so that the cell can survive (there may be more than one correct answer)? a. A mutation restoring the codon to one encoding the original amino acid b. A mutation changing the nonsense codon to one encoding a different but similar amino acid c. A mutation in the anticodon of a tRNA such that the tRNA now recognizes the nonsense codon d. A mutation in which an additional nucleotide inserts just upstream of the nonsense codon, changing the reading frame so the nonsense codon is no longer read as "stop"

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG \(\left(3^{\prime}\right)\) a. What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5 ' end? c. If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.