/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 9 Synthetic mRNAs The genetic code... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Synthetic mRNAs The genetic code was elucidated through the use of polyribonucleotides synthesized either enzymatically or chemically in the laboratory. Given what we now know about the genetic code, how would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and for a small number of Leu and Ser residues? What other amino acid(s) would be encoded by this polyribonucleotide, but in smaller amounts?

Short Answer

Expert verified
Use UUU and UUC codons for Phe; add UUA and UCU for Leu and Ser, respectively, to create a polyribonucleotide.

Step by step solution

01

Understanding Codons for Phe

First, identify the codons that code for the amino acid phenylalanine (Phe). Phe is coded by the codons UUU and UUC. These codons will be the primary focus for creating a polyribonucleotide that predominantly codes for Phe residues.
02

Adding Codons for Leu and Ser

Next, identify the codons for leucine (Leu) and serine (Ser). Leu is coded by UUA, UUG, CUU, CUC, CUA, and CUG while Ser is coded by UCU, UCC, UCA, UCG, AGU, and AGC. To predominantly code for Phe but also include Leu and Ser, UUA, and UCU may be used as they can appear less frequently.
03

Identifying Other Amino Acids

Any additional codons like UUG (for Leu) or UCC (for Ser) could in theory appear, though these would be less frequent. Consider that there may be little sequence redundancy if using random copolymers, consequently not introducing significant amounts of other amino acids beyond those planned for.
04

Constructing the Sequence

Construct the polyribonucleotide sequence by using a higher proportion of UUU and UUC sequences. Occasionally, introduce UUA (for Leu) and UCU (for Ser) to the sequence. A possible pattern could be repeated stretches like: UUUUUUUUUUCUUCU. This would predominantly translate into Phe with occasional Leu and Ser.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

mRNA Synthesis
The process of mRNA synthesis is also known as transcription. It begins when an enzyme called RNA polymerase binds to a segment of DNA and uses it as a template to build a complementary RNA strand. This strand is called messenger RNA (mRNA) because it carries the genetic information from DNA to the cell’s ribosome, where proteins are made.

During transcription, RNA nucleotides pair with their complementary DNA partners, where adenine (A) pairs with uracil (U) in RNA instead of thymine (T), which is found in DNA. Other pairings include cytosine (C) with guanine (G), and vice versa. This synthesized mRNA strand is essential for translating genetic information into proteins.

It’s important to understand that the mRNA sequence directly determines the sequence of amino acids in a protein. Each set of three bases, known as a codon, specifies a particular amino acid. In synthesizing mRNA that will code predominantly for phenylalanine (Phe), the sequence will include repetitive sequences like UUU or UUC for Phe, amongst others for different amino acids. This is a crucial step in producing specific proteins.
Codon Usage
Codon usage is vital in understanding how genes are translated into proteins. It refers to how frequently specific codons are used to code for an amino acid. Each triplet of nucleotides in mRNA forms a codon that corresponds to an amino acid or a termination signal during protein synthesis. The genetic code is redundant, meaning multiple codons can code for the same amino acid.

For example, phenylalanine (Phe) can be coded by both UUU and UUC codons, meaning that
  • UUU and UUC are both efficient codons for phenylalanine.
  • To ensure a predominant coding for Phe, a sequence should largely consist of UUU and UUC.
To introduce occasional coding for leucine (Leu) and serine (Ser), one might use UUA and UCU. Use of these codons allows for variability within the polyribonucleotide without significantly changing the protein's primary composition. This strategy effectively designs sequences with a desired codon frequency, serving the purpose of selective protein synthesis.
Amino Acid Coding Patterns
Amino acid coding patterns describe how the sequence of nucleotides in mRNA are read in groups of three bases to translate into specific amino acids. The meaning of these codons in mRNA is determined by the genetic code, which is nearly universal among organisms and has been comprehensively mapped.

Understanding these patterns is key to manipulating protein production in research and synthetic biology. For instance, if a researcher wants a polyribonucleotide to primarily produce phenylalanine, they will incorporate many UUU and UUC codons into their sequence pattern. This means:
  • High UUU and UUC content results in frequent phenylalanine.
  • Smaller amounts of UUA and UCU codons introduce occasional leucine and serine, respectively.
Random copolymers can introduce unpredictable elements; however, deliberate codon arrangement within mRNA can lead to effective and controlled protein synthesis. This precision allows for targeted biological function and innovation, forming the basis for advancements in genetic engineering and biotechnology.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Predicting Anticodons from Codons Most amino acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible anticodons for the four codons of glycine: \(\left(5^{\prime}\right) \mathrm{GGU}, \mathrm{GGC}\), GGA, and GGG. a. From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine? b. Which of these anticodon-codon pairings has/have a wobbly base pair? c. In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.