Chapter 27: Problem 8
The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU
Short Answer
Step by step solution
Identify Codons
Determine the Corresponding Amino Acids
Apply Wobble Rules
Calculate Distinct tRNAs Needed
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
Codons
Codons are universal among most organisms, meaning the same codon codes for the same amino acid in almost all living beings. In the mRNA sequence, codons are read in the 5' to 3' direction. Each group of three nucleotides makes one codon, and each codon corresponds to a specific amino acid or a functional signal (start or stop codons). For example:
- AUG is a start codon and codes for Methionine.
- UAA, UAG, and UGA are stop codons which signal the end of a protein chain.
Wobble Rules
This phenomenon allows for efficient use of the tRNAs available within the cell by reducing the number needed to decode all 61 sense codons (those that specify an amino acid) into just 31 or so different tRNAs.
For example, a tRNA with an anticodon sequence that pairs with GGU on the mRNA can recognize codons GGA, GGC, or GGG as well, thus coding for Glycine with just one tRNA. This wobble base-pairing is a property of the genetic code that helps maintain its efficiency without needing separate tRNAs for each codon.
tRNA
The tRNA's structure resembles a cloverleaf when drawn on paper, and it contains both an anticodon site and an amino acid attachment site. Through this anticodon, the tRNA binds to its complementary mRNA codon during translation. This binding ensures the addition of the correct amino acid in the growing polypeptide chain.
The process works as follows:
- A tRNA slightly "bends" due to its structure allowing for "wobble" base pairing flexibility.
- Once bound, the ribosome facilitates peptide bond formation between the arriving amino acid and the growing polypeptide chain.
- This process continues as the ribosome shifts along the mRNA, reading the next codon until a stop codon is reached.
Amino Acids
The sequence and composition of amino acids dictate a protein's structure and function, and understanding them is vital when studying genetic code translation. In the genetic code:
- Each codon specifies a particular amino acid, forming a precise blueprint for proteins.
- For example, Methionine (AUG), Glycine (GGU), Arginine (CGU), and so on.
- These sequences determine the diversity of protein functions essential for cellular life, including enzyme activity, structural support, and cell signaling.