/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 8 The Genetic Code in Action Trans... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

Short Answer

Expert verified
8 distinct tRNAs are required.

Step by step solution

01

Identify Codons

The mRNA sequence is given as 5' AUG GGU CGU GAG UCA UCG UUA AU 3'. To identify the codons, split the sequence into groups of three nucleotides each. These codons will be translated by tRNA: AUG, GGU, CGU, GAG, UCA, UCG, UUA.
02

Determine the Corresponding Amino Acids

Using the genetic code, translate each codon to its corresponding amino acid: AUG (Methionine), GGU (Glycine), CGU (Arginine), GAG (Glutamic Acid), UCA (Serine), UCG (Serine), UUA (Leucine).
03

Apply Wobble Rules

The wobble rules allow flexibility at the third position of the codon for tRNA. For example, GGU can be translated by tRNA with anticodons pairing with any base that recognizes Glycine (GGU, GGC, GGA, GGG), requiring just one tRNA for Glycine.
04

Calculate Distinct tRNAs Needed

Considering each amino acid and wobble rules: Methionine requires 1 distinct tRNA; Glycine requires 1; Arginine could potentially require two distinct tRNAs due to the wobble at U and C positions (CGU and CGC); Glutamic Acid requires 1; Serine could be translated by 2 distinct tRNAs for UCA and UCG due to different third base pairing; Leucine may require 2 distinct tRNAs since UUA can be read by Leu recognizing codons UUA and UUG. Overall, we have at most 9 tRNAs required, but because UCG and CGU could share tRNA recognizing both due to pairing flexibility, we settle on 8 tRNAs.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Codons
Codons are sequences of three nucleotides in messenger RNA (mRNA) that correspond to specific amino acids or signal a start or a stop to protein synthesis. These triplets are read by the ribosome during translation, ensuring that the genetic information is translated into the correct sequence of amino acids to form proteins.
Codons are universal among most organisms, meaning the same codon codes for the same amino acid in almost all living beings. In the mRNA sequence, codons are read in the 5' to 3' direction. Each group of three nucleotides makes one codon, and each codon corresponds to a specific amino acid or a functional signal (start or stop codons). For example:
  • AUG is a start codon and codes for Methionine.
  • UAA, UAG, and UGA are stop codons which signal the end of a protein chain.
Wobble Rules
The Wobble Rules are fascinating principles in molecular biology that explain how a single tRNA molecule can recognize multiple codons for the same amino acid. These rules provide "flexibility" in base pairing. The flexibility occurs at the third position of the codon and the first position of the anticodon in the tRNA.
This phenomenon allows for efficient use of the tRNAs available within the cell by reducing the number needed to decode all 61 sense codons (those that specify an amino acid) into just 31 or so different tRNAs.
For example, a tRNA with an anticodon sequence that pairs with GGU on the mRNA can recognize codons GGA, GGC, or GGG as well, thus coding for Glycine with just one tRNA. This wobble base-pairing is a property of the genetic code that helps maintain its efficiency without needing separate tRNAs for each codon.
tRNA
Transfer RNA (tRNA) plays a crucial role in interpreting the genetic information encoded in mRNA into proteins. tRNA is responsible for transferring the appropriate amino acids in line with the codons in the mRNA. Each tRNA molecule has a unique anticodon, a specific sequence of three bases complementary to the codons in mRNA.
The tRNA's structure resembles a cloverleaf when drawn on paper, and it contains both an anticodon site and an amino acid attachment site. Through this anticodon, the tRNA binds to its complementary mRNA codon during translation. This binding ensures the addition of the correct amino acid in the growing polypeptide chain.
The process works as follows:
  • A tRNA slightly "bends" due to its structure allowing for "wobble" base pairing flexibility.
  • Once bound, the ribosome facilitates peptide bond formation between the arriving amino acid and the growing polypeptide chain.
  • This process continues as the ribosome shifts along the mRNA, reading the next codon until a stop codon is reached.
Amino Acids
Amino acids are the building blocks of proteins, which are essential molecules that perform a vast range of functions in living organisms. Each amino acid consists of a central carbon atom, an amino group, a carboxyl group, a hydrogen atom, and a variable side chain (R-group) that determines its unique properties.
The sequence and composition of amino acids dictate a protein's structure and function, and understanding them is vital when studying genetic code translation. In the genetic code:
  • Each codon specifies a particular amino acid, forming a precise blueprint for proteins.
  • For example, Methionine (AUG), Glycine (GGU), Arginine (CGU), and so on.
  • These sequences determine the diversity of protein functions essential for cellular life, including enzyme activity, structural support, and cell signaling.
Understanding the role of amino acids in proteins helps in appreciating how genetic mutations can alter protein function, potentially leading to various genetic disorders or adaptational changes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and the interior Met residues of polypeptides synthesized by \(E\). coli?

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG \(\left(3^{\prime}\right)\) a. What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5 ' end? c. If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

Requirements for Protein Translocation across a Membrane The secreted bacterial protein OmpA has a precursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If you denature purified ProOmpA with \(8 \mathrm{M}\) urea and then remove the urea (such as by running the protein solution rapidly through a gel filtration column), the protein can translocate across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if you first incubate ProOmpA for a few hours in the absence of urea. Furthermore, ProOmpA maintains its capacity for translocation for an extended period if you first incubate it in the presence of another bacterial protein called trigger factor. Describe the probable function of trigger factor.

Protein-Coding Capacity of a Viral DNA The \(5,386 \mathrm{bp}\) genome of bacteriophage \(\phi \times 174\) includes genes for 10 proteins, designated A to \(\mathrm{K}\) (omitting "I"), with sizes given in the table. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the \(\phi \mathrm{X} 174\) genome with its protein-coding capacity? \begin{tabular}{ccc} Protein & Number of amino acid residues & Protein & Number of amino acid residues \\ \hline \end{tabular} \begin{array}{llll} \text { A } & 455 & 427 \\ \text { B } & 120 & \text { F } & 175 \\ \text { C } & 86 & \text { H } & 328 \\ \text { D } & 152 & \text { J } & 38 \\ \text { E } & 91 & \text { K } & 56 \\ \hline \end{array}

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.