/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 7 Methionine Has Only One Codon Me... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and the interior Met residues of polypeptides synthesized by \(E\). coli?

Short Answer

Expert verified
AUG codon serves both as an initiation signal with tRNA^fMet and as an interior Met residue marker with tRNA^Met.

Step by step solution

01

Understand Codons and Methionine

Methionine is an amino acid that is uniquely specified by only one codon, AUG, in the genetic code. This codon plays a crucial role in the initiation of protein synthesis.
02

Role of AUG Codon

The AUG codon serves a dual purpose: it codes for Methionine both as a starting signal for the ribosome to initiate protein synthesis, and as an indicator for the incorporation of Methionine into the interior of a protein chain. This versatility is integral to E. coli's polypeptide synthesis.
03

Mechanism of Initiation

In the initiation of protein synthesis in E. coli, the AUG codon is recognized by a special initiator tRNA called tRNA^fMet, which is modified to carry formyl-methionine (fMet). This distinct form allows the cell machinery to recognize the start of a protein.
04

Incorporation of Interior Methionine

When AUG codon appears in the middle of a mRNA sequence, it is recognized by a different tRNA, called tRNA^Met, that brings a regular Methionine to the growing peptide chain, differentiating it from the initiation role.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Methionine
Methionine is a special amino acid because it is one of the two amino acids that are specified by a single codon, which in this case is AUG. It holds an essential position in protein synthesis as it serves as the starting amino acid in nearly all newly synthesized polypeptide chains. Methionine is important not only because of its role as an initiator but also because it can be found within the interior of proteins.
  • Methionine's unique single-codon specification gives it a distinct function in biochemical processes.
  • It plays a vital role both at the initiation of protein synthesis and in various structural and functional parts of proteins once the initial synthesis is complete.
AUG Codon
The AUG codon is the genetic sequence that codes for methionine. Its significance extends beyond just coding for an amino acid. It serves a dual purpose in the genetic code.
  • Firstly, AUG acts as the start codon in mRNA, signaling the ribosome where to begin translating the genetic message into a protein.
  • Secondly, it is also used to code for methionine when it appears within a protein being synthesized.
This versatility ensures that proteins are synthesized correctly and that methionine is incorporated both as the initial segment and within the growing protein structure. The ability of the AUG codon to perform such distinct roles highlights the complexity and efficiency of genetic coding mechanisms.
Protein Synthesis
Protein synthesis is the process by which cells build proteins, and it begins with the role of methionine and the AUG codon. Upon encountering the AUG codon at the start of an mRNA strand, the ribosome initiates translation, commencing the assembly of a polypeptide chain.
  • This process begins with the recognition of the AUG codon as the start codon, marking the spot for the ribosomal machinery to assemble and start synthesizing the protein.
  • The initiation of protein synthesis is critically dependent on the presence of a specialized tRNA that aids in this process (tRNA^fMet in E. coli).
  • Methionine marks the beginning, but other amino acids soon follow, added by various tRNA molecules as the ribosome travels along the mRNA sequence.
Protein synthesis is fundamental for cell function and involves intricate processes that ensure proteins are built efficiently and accurately.
tRNA
Transfer RNA (tRNA) acts as an adapter molecule in protein synthesis, linking codons in the mRNA to the appropriate amino acids. It plays an essential role in ensuring proteins are built with the correct sequence of amino acids.
  • tRNA molecules have anticodons, which are complementary to codons in the mRNA. This allows them to bring the right amino acids to the ribosome for protein assembly.
  • In the case of methionine, two types of tRNA are involved: tRNA^fMet, which recognizes the start codon AUG and brings formyl-methionine to initiate protein synthesis, and tRNA^Met, which incorporates regular methionine into the peptide chain interior.
tRNA's ability to interpret the genetic code and deliver specific amino acids is crucial for the accuracy and effectiveness of protein synthesis. Each tRNA is specific to one amino acid, making it a vital player in translating genetic information into functional proteins.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Rate of Protein Synthesis A bacterial ribosome can synthesize about 20 peptide bonds per minute. If the average bacterial protein is approximately 260 amino acid residues long, how many proteins can the ribosomes in an \(E\). coli cell synthesize in 20 minutes if all ribosomes are functioning at maximum rates?

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the \(\beta\)-globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG \(\left(3^{\prime}\right)\) a. What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5 ' end? c. If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.