/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 6 The Direction of Protein Synthes... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The Direction of Protein Synthesis In 1961, Howard Dintzis established that protein synthesis on ribosomes begins at the amino terminus and proceeds toward the carboxyl terminus. He used immature red blood cells that were still synthesizing hemoglobin. He added radioactively labeled leucine (chosen because it occurs frequently in both the \(a\) and \(\beta\) subunits) for various lengths of time, rapidly isolated only the full-length (completed) \(a\) subunits, and then determined where in the peptide the labeled amino acids were located. After the labeled leucine and extract had been incubated together for one hour, the protein was labeled uniformly along its length. However, after much shorter incubation times, the labeled amino acids were clustered at one end. At which end, amino or carboxyl terminus, did Dintzis find the labeled residues after the short exposure to labeled leucine?

Short Answer

Expert verified
The labeled residues were found at the amino terminus after short exposure.

Step by step solution

01

Understanding Protein Synthesis

Protein synthesis occurs in a specific direction on the ribosome. The synthesis begins at the amino (N) terminus and continues to the carboxyl (C) terminus as new amino acids are added.
02

Experiment Design Analysis

Howard Dintzis used red blood cells actively synthesizing hemoglobin to study the direction of protein synthesis. He introduced radioactively labeled leucine into the system, which was incorporated into newly synthesized proteins.
03

Interpreting Short Incubation Results

After a short incubation with the labeled leucine, the newly synthesized amino acids showed clusters of labeled residues at one end of the hemoglobin chain. This indicates the start of the protein synthesis.
04

Determining the Direction of Synthesis

In Dintzis's experiment, if the labeled residues clustered at the same end, it would represent the recently synthesized portion of the chain. Given that synthesis starts at the amino terminus, clusters at the amino terminus suggest recent synthesis.
05

Conclusion

Based on Dintzis’s results, the labeled residues after short exposure were found at the amino terminus, confirming that protein synthesis proceeds from the amino to the carboxyl terminus.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Ribosome Function
Ribosomes are essential molecular machines in cells responsible for synthesizing proteins. They serve as the sites where genetic information, in the form of messenger RNA (mRNA), is translated into proteins. This process is critical for cellular function and overall organismal health.

The ribosome is composed of two subunits: the small and the large subunits. These two parts come together to form a complete ribosome when synthesizing proteins. The small subunit binds to the mRNA, while the large subunit facilitates the binding of transfer RNA (tRNA) and the formation of peptide bonds.

The ribosomes read the mRNA in segments of three bases known as codons. Each codon corresponds to a specific amino acid, directing the tRNA to deliver the correct building block for the protein chain being assembled. This process continues until a stop codon is encountered, signaling the ribosome to release the completed protein.
  • The small subunit reads mRNA.
  • The large subunit forms peptide bonds.
  • Translation ends at stop codons.
Directionality of Protein Synthesis
Protein synthesis is a highly directional process that starts at the amino (N) terminus of a protein and proceeds towards the carboxyl (C) terminus. This directionality is a fundamental aspect of protein biosynthesis and ensures proper assembly of the protein sequence.

In Howard Dintzis's classic experiment, it was demonstrated that protein synthesis initiates at the amino terminus. By using radioactively labeled leucine, Dintzis could track where new amino acids were incorporated during hemoglobin synthesis in red blood cells. Following brief periods of incubation, the experimental results showed clusters of labeled leucine at the amino terminus, confirming that this is where synthesis starts.

This directed flow of synthesis is not arbitrary. The ribosome moves along the mRNA chain in a 5' to 3' direction, ensuring that proteins elongate correctly as the ribosome reads the codons.
  • Synthesis starts at the amino terminus.
  • Experiments confirmed the directional flow.
  • Ribosomes move in a 5' to 3' direction along mRNA.
Experiment Design in Biochemistry
Designing experiments in biochemistry requires careful selection of materials, well-thought-out procedures, and controls to ensure reliable and valid results. In the context of protein synthesis, Dintzis's experiment serves as a model for how to effectively design and execute a biochemical study.

First, it is crucial to select a suitable biological system. Dintzis chose immature red blood cells because they were still actively synthesizing proteins. This choice allowed him to observe protein synthesis in real-time. Choosing the right biochemical markers is another important element. In this experiment, radioactively labeled leucine was the marker of choice because it appears frequently in hemoglobin, making it easier to monitor incorporation.

Another key aspect is the timing and conditions of the experiment. Short incubations helped identify which end of the protein became labeled first. This strategic approach enables researchers to pinpoint specific stages in a biochemical process. Finally, interpreting the data correctly is vital. By correlating the labeled cluster's location with known synthesis directionality, reliable conclusions can be drawn.
  • Choose an active biological system.
  • Select appropriate biochemical markers.
  • Use strategic timing to observe processes.
  • Ensure accurate data interpretation.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Bacterial Protein Export Bacteria mostly use the system shown in Eig \(27-44\) to export proteins out of the cell. SecB, one of the chaperone proteins found only in gram-negative bacteria, delivers a newly translated polypeptide to the SecA ATPase on the interior side of the membrane. SecA pushes the exported protein through a membrane pore formed by the SecYEG complex. The SecYEG complex is homologous to the Sec61 complex in eukaryotes. Which component of this bacterial protein export system would be the most attractive target for antibiotic development? Explain.

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

Protein-Coding Capacity of a Viral DNA The \(5,386 \mathrm{bp}\) genome of bacteriophage \(\phi \times 174\) includes genes for 10 proteins, designated A to \(\mathrm{K}\) (omitting "I"), with sizes given in the table. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the \(\phi \mathrm{X} 174\) genome with its protein-coding capacity? \begin{tabular}{ccc} Protein & Number of amino acid residues & Protein & Number of amino acid residues \\ \hline \end{tabular} \begin{array}{llll} \text { A } & 455 & 427 \\ \text { B } & 120 & \text { F } & 175 \\ \text { C } & 86 & \text { H } & 328 \\ \text { D } & 152 & \text { J } & 38 \\ \text { E } & 91 & \text { K } & 56 \\ \hline \end{array}

Rate of Protein Synthesis A bacterial ribosome can synthesize about 20 peptide bonds per minute. If the average bacterial protein is approximately 260 amino acid residues long, how many proteins can the ribosomes in an \(E\). coli cell synthesize in 20 minutes if all ribosomes are functioning at maximum rates?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.