/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 20 Bacterial Protein Export Bacteri... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Bacterial Protein Export Bacteria mostly use the system shown in Eig \(27-44\) to export proteins out of the cell. SecB, one of the chaperone proteins found only in gram-negative bacteria, delivers a newly translated polypeptide to the SecA ATPase on the interior side of the membrane. SecA pushes the exported protein through a membrane pore formed by the SecYEG complex. The SecYEG complex is homologous to the Sec61 complex in eukaryotes. Which component of this bacterial protein export system would be the most attractive target for antibiotic development? Explain.

Short Answer

Expert verified
SecB is the best target due to its specificity to gram-negative bacteria.

Step by step solution

01

Understanding Components

First, identify the components involved in the bacterial protein export system: SecB (chaperone protein in gram-negative bacteria), SecA (ATPase), and the SecYEG complex (membrane pore). These work together to transport proteins from the interior of the bacterial cell to its exterior.
02

Evaluate Potential Targets

To determine which component is the most attractive target for antibiotic development, consider the uniqueness of each component. SecB is unique to gram-negative bacteria, suggesting specificity in targeting. SecA, as an ATPase, is crucial for energy-dependent processes. The SecYEG complex is homologous to eukaryotic Sec61, risking off-target effects if inhibited.
03

Select the Target

Select a target based on specificity and potential impact. Targeting SecB could disrupt protein export specifically in gram-negative bacteria without affecting human cells, making it a potentially effective and selective target for antibiotics.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Chaperone Proteins
Chaperone proteins play a fundamental role in assisting newly synthesized polypeptide chains to fold into their correct three-dimensional structures. This is crucial because the proper folding of proteins is essential for them to function appropriately in the cell.
The chaperone protein SecB, in particular, is specialized to interact with unfolded or partially folded proteins, transporting them to specific sites within the cell for further processing. In the context of bacterial protein export, SecB targets the SecA ATPase, helping direct proteins to the correct pathways.
  • Prevents misfolding
  • Ensures proteins reach their destination
  • Unique function in gram-negative bacteria, making it an antibiotic target
SecB's uniqueness in gram-negative bacteria allows for targeted antibiotic strategies, focusing on disrupting protein folding and transport without affecting the host's own cellular processes.
ATPase
ATPases are enzymes that catalyze the decomposition of ATP into ADP and a phosphate ion. This reaction releases energy, which is then harnessed for various cellular processes. In the bacterial protein export system, SecA is the ATPase that plays a key role.
SecA uses the energy from ATP hydrolysis to push the protein through the translocon channel formed by the SecYEG complex. This energy-driven mechanism is critical for actively transporting proteins across the cell membrane.
  • Generates energy from ATP
  • Facilitates active transport of proteins
  • Essential for bacterial viability
By targeting ATPase functions, it is conceivable to cripple the energy supply of bacteria, potentially halting their ability to survive and propagate, making ATPases a point of interest in antibiotic design.
Gram-negative Bacteria
Gram-negative bacteria are characterized by their distinct cell wall structure, which includes a thin peptidoglycan layer sandwiched between an inner cytoplasmic cell membrane and an outer membrane containing lipopolysaccharides. This unique envelope makes gram-negative bacteria generally more resistant to antibiotics than their gram-positive counterparts.
SecB, a chaperone unique to this group, assists in exporting proteins necessary for the bacteria's defense and metabolism through the characteristic two-membrane system.
  • Outer membrane provides additional defense
  • More resistant to many antibiotics
  • Specific targets can overcome this resistance
Understanding the structure and function of gram-negative bacteria is vital to developing antibiotics that can penetrate their additional defenses, making components like SecB valuable targets.
SecYEG Complex
The SecYEG complex forms a translocon channel through the bacterial cell membrane, creating a passageway for proteins to be transported across the membrane. Made up of multiple subunits, its configuration resembles the eukaryotic Sec61 complex.
However, because of its structural similarities between bacterial and eukaryotic translocons, targeting SecYEG for antibiotics poses the risk of affecting similar processes in human cells, leading to potential side effects.
  • Forms the protein translocation pore in membranes
  • Conserved structure limits specificity of targeting
  • Strategic targeting requires careful consideration
Its critical role and ubiquitous presence make it a less desirable antibiotic target, emphasizing the need for precision in drug design.
Antibiotic Targeting
Developing antibiotics is a strategic endeavor, choosing targets in bacteria that will minimize harm to the host. The preference is typically for structures or mechanisms unique to the bacteria to ensure high specificity.
Targeting chaperones or ATPase associated proteins such as SecB and SecA can allow for the selective disruption of bacterial processes while minimizing side effects on human cells. These components' essential roles and distinctive characteristics present lucrative avenues for pharmaceutical exploration.
  • Focus on bacterial-specific components
  • Avoid human cell analogs
  • Balance efficacy with minimized host effects
The unique features of parts involved in bacterial protein export like SecB make them prime candidates for antibiotics, potentially revolutionizing treatments against gram-negative bacterial infections.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the \(\beta\)-globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

Proofreading by Aminoacyl-tRNA Synthetases The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.