/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 22 Requirements for Protein Translo... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Requirements for Protein Translocation across a Membrane The secreted bacterial protein OmpA has a precursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If you denature purified ProOmpA with \(8 \mathrm{M}\) urea and then remove the urea (such as by running the protein solution rapidly through a gel filtration column), the protein can translocate across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if you first incubate ProOmpA for a few hours in the absence of urea. Furthermore, ProOmpA maintains its capacity for translocation for an extended period if you first incubate it in the presence of another bacterial protein called trigger factor. Describe the probable function of trigger factor.

Short Answer

Expert verified
Trigger factor likely functions as a molecular chaperone, maintaining ProOmpA's translocation-competent conformation.

Step by step solution

01

Understanding the Problem

The problem involves the translocation of a bacterial protein, ProOmpA, across a membrane. Denatured ProOmpA can translocate across membranes after removing urea. However, if ProOmpA is incubated without urea, its translocation ability is lost, unless another protein, trigger factor, is present.
02

Analyzing Experimental Observations

When ProOmpA is denatured and quickly processed to remove urea, it can translocate across the membrane, suggesting that the protein must be in an unfolded or partially unfolded state for translocation. Incubation without urea likely leads to ProOmpA folding into a conformation that cannot translocate. When trigger factor is present, ProOmpA maintains its ability to translocate.
03

Inferring Trigger Factor's Role

The consistent translocation ability of ProOmpA in the presence of trigger factor implies that this protein assists in the proper folding or maintaining the suitable conformation of ProOmpA that is necessary for translocation, even in the absence of urea.
04

Conclusion

The probable function of the trigger factor is to act as a chaperone, preventing improper folding or maintaining an unfolded or translocation-competent state of ProOmpA, thus facilitating or permitting translocation across the membrane.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Trigger Factor
The trigger factor is an important protein that plays a crucial role in helping other proteins achieve the right structure for their function. It is known as a molecular chaperone. Molecular chaperones assist newly synthesized proteins in folding correctly. If proteins do not fold properly, they may not function correctly or could even become harmful to the cell. The trigger factor binds to nascent protein chains and prevents premature folding. This is particularly important in crowded cellular environments where proteins are synthesized rapidly.

In the context of ProOmpA, a bacterial protein important for membrane translocation, the trigger factor ensures it remains in a translocation-competent form. When ProOmpA is denatured and urea is removed, the molecules are in an unfolded state. However, without the trigger factor, they might misfold upon incubation and become ineffective for translocation. By binding to ProOmpA, the trigger factor maintains the unfolded or partially unfolded conformation essential for successful membrane passage.
Protein Folding
Protein folding is the process by which a protein structure assumes its functional shape or conformation. The sequence of amino acids in a protein determines its final 3-dimensional structure, which in turn determines the protein's function.

There are several stages in protein folding, initiated immediately after the amino acid chain leaves the ribosome. This process can sometimes lead to intermediate states that need guidance to achieve full functionality. Chaperones, like the trigger factor, provide this assistance. Improper folding not only reduces functionality but can also result in harmful aggregations within the cell, possibly leading to diseases.

In particular, for membrane translocation, proteins must often retain an unfolded state to pass through membrane pores. As seen with ProOmpA, folding must be carefully regulated as premature folding can hinder the effectiveness of the translocation process.
Membrane Transport
Membrane transport involves the movement of substances across the cell membrane. This is indispensable for functions like nutrient uptake, signaling, and waste removal. Proteins, especially large ones like ProOmpA, require specific mechanisms for successful movement across membranes.

There are two main types of membrane transport: passive and active. However, protein translocation is usually an active process and often involves pores or protein channels that facilitate movement. In this context, the bacterial inner membrane acts as a barrier that ProOmpA must pass.

ProOmpA requires being in the correct conformation to be transported across the membrane. The trigger factor plays a crucial role here by ensuring ProOmpA remains in a conformation suitable for translocation. This highlights the interplay between folding and transport, where proper folding mechanisms or the lack thereof can directly impact a protein's transportation across membranes.
Signal Sequence
A signal sequence is a short peptide found at the beginning of the protein synthesis process. It acts like an address label that directs the protein to its correct destination in the cell, often towards membranes for translocation.

In the case of ProOmpA, the amino-terminal signal sequence is critical for secretion across the bacterial membrane. This sequence is recognized by the cellular machinery to initiate the translocation process. Signal sequences often get cleaved off once the protein reaches its destination, ensuring that the remaining protein can now fold into its functional form.

Understanding signal sequences highlights the precision of cellular processes. They must be appropriately recognized and processed to ensure each protein reaches its destination without being misdirected. In vitro experiments with ProOmpA showcase how removing such sequences might hinder transport, serving as a testament to their importance in protein sorting and correct localization.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and the interior Met residues of polypeptides synthesized by \(E\). coli?

Bacterial Protein Export Bacteria mostly use the system shown in Eig \(27-44\) to export proteins out of the cell. SecB, one of the chaperone proteins found only in gram-negative bacteria, delivers a newly translated polypeptide to the SecA ATPase on the interior side of the membrane. SecA pushes the exported protein through a membrane pore formed by the SecYEG complex. The SecYEG complex is homologous to the Sec61 complex in eukaryotes. Which component of this bacterial protein export system would be the most attractive target for antibiotic development? Explain.

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

Messenger RNA Translation Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the reading frame begins with the first three bases in each sequence. a. GGUCAGUCGCUCCUGAUU b. UUGGAUGCGCCAUAAUUUGCU c. CAUGAUGCCUGUUGCUAC d. AUGGACGAA

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.