/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 17 Rate of Protein Synthesis A bact... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Rate of Protein Synthesis A bacterial ribosome can synthesize about 20 peptide bonds per minute. If the average bacterial protein is approximately 260 amino acid residues long, how many proteins can the ribosomes in an \(E\). coli cell synthesize in 20 minutes if all ribosomes are functioning at maximum rates?

Short Answer

Expert verified
Each ribosome can synthesize 1 complete protein in 20 minutes.

Step by step solution

01

Determine the Time for One Protein

First, calculate how long it takes to synthesize a single protein. With the synthesis rate of 20 peptide bonds per minute and a protein length of 260 amino acids, we can calculate the time needed to complete one protein:The time (in minutes) is calculated as:\[ \text{Time for one protein} = \frac{\text{Protein length}}{\text{Rate of synthesis}} = \frac{260}{20} \]Simplifying gives:\[ 13 \text{ minutes per protein} \]
02

Calculate Total Proteins in Given Time

Next, determine how many such proteins can be synthesized in the given time frame of 20 minutes. The formula to use is:\[ \text{Number of proteins} = \frac{\text{Total time available}}{\text{Time per protein}} = \frac{20}{13} \]Calculating gives approximately:\[ 1.54 \text{ proteins} \]
03

Interpret the Result

Since it is not possible to synthesize a fraction of a protein, we can conclude that each ribosome produces 1 complete protein in the given time.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Bacterial Ribosome
The bacterial ribosome plays a crucial role in the process of protein synthesis. It acts as the machinery where proteins are assembled, reading the genetic code and translating it into functional proteins. Each ribosome consists of two subunits, which come together to form the active site for protein synthesis.
Bacterial ribosomes are slightly smaller than eukaryotic ribosomes, with a sedimentation coefficient of 70S (Svedberg units), compared to the 80S found in eukaryotes.
  • The small subunit reads the mRNA sequence.
  • The large subunit links amino acids to form proteins.
Each component of the ribosome, proteins, and rRNA, plays a specific role in accurately translating the genetic code into a chain of amino acids.
The efficiency of ribosomes is critical in allowing bacterial cells, like those in *E. coli*, to adapt rapidly to environmental changes by quickly synthesizing necessary proteins.
Amino Acid Residues
Amino acid residues are the building blocks of proteins, which are synthesized by ribosomes. They link together in a specific sequence to form polypeptide chains.
These sequences determine the structure and function of the resulting protein. During protein synthesis, tRNA molecules bring amino acids to the ribosome, where they are added to the growing polypeptide chain.
  • There are 20 standard amino acids used in protein building.
  • Each has a unique side chain that affects protein folding and function.
The term "residue" refers to amino acids as they are incorporated into proteins, subtracting a water molecule through dehydration synthesis.
This condensation reaction is part of the formation of peptide bonds, the next step in developing a complete protein structure.
Peptide Bonds
Peptide bonds are the links that hold amino acids together, forming a polypeptide chain. These covalent chemical bonds connect the carboxyl group of one amino acid to the amino group of the next, releasing a water molecule in the process.
  • The creation of each peptide bond releases energy, aiding in protein folding.
  • They provide structural stability to proteins.
In bacterial ribosomes, peptide bond formation is catalyzed by an RNA molecule within the large ribosomal subunit, known as the peptidyl transferase center. This enzyme accelerates the reaction, allowing for rapid protein synthesis.
For example, in *E. coli*, these peptide connections enable fast growing conditions, vital for survival and adaptation.
E. coli
*E. coli* is a type of bacteria commonly found in the intestines of warm-blooded organisms. It is often used as a model organism in biotechnology and microbiology due to its rapid growth and ease of genetic manipulation.
This bacterium benefits from its efficient ribosomes, which can synthesize proteins quickly, allowing it to respond swiftly to changing environments.
  • *E. coli* cells typically reproduce quickly, often doubling every 20 minutes.
  • They are instrumental in studies of molecular biology and genetic engineering.
Understanding how *E. coli* ribosomes function gives insights into bacterial protein synthesis, helping us comprehend broader biological processes.
Additionally, because *E. coli* is well-studied, findings often translate to applications in medicine, such as antibiotic development and understanding bacterial resistance mechanisms.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. a. What features of tRNA \(^{\text {Ala }}\) does Ala-tRNA synthetase recognize? b. Describe the consequences of a \(\mathrm{C} \rightarrow \mathrm{G}\) mutation in the third position of the anticodon of \(\mathrm{tRNA}^{\mathrm{Ala}}\). c. What other kinds of mutations might have similar effects? d. Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.)

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.