/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 Importance of the "Second Geneti... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. a. What features of tRNA \(^{\text {Ala }}\) does Ala-tRNA synthetase recognize? b. Describe the consequences of a \(\mathrm{C} \rightarrow \mathrm{G}\) mutation in the third position of the anticodon of \(\mathrm{tRNA}^{\mathrm{Ala}}\). c. What other kinds of mutations might have similar effects? d. Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.)

Short Answer

Expert verified
Ala-tRNA synthetase recognizes tRNA structure. A C→G mutation alters codon pairing. Such mutations are not favored as they disrupt protein function.

Step by step solution

01

Understand the Context

Aminoacyl-tRNA synthetases charge tRNAs with the correct amino acids. Some do not use the anticodon as recognition but rely on other tRNA features to ensure proper amino acid attachment.
02

Determine Ala-tRNA Recognition Features

Ala-tRNA synthetase recognizes the G-U base pairing in the acceptor stem of tRNA\(^{\text{Ala}}\), which is crucial for the enzyme's specificity.
03

Consequences of a C→G Mutatation in the tRNA Anticodon

A mutation from C to G in the third position of the anticodon of tRNA\(^{\text{Ala}}\) does not affect aminoacylation but may alter how the tRNA pairs with mRNA codons during translation, potentially leading to incorrect amino acid incorporation.
04

Potential Effects of Similar Mutations

Similar mutations could occur in the anticodon or other regions affecting base pairing with mRNA, leading to changes in protein sequences during translation.
05

Reason for Absence of Such Mutations in Natural Populations

Mutations impacting tRNA recognition can cause misincorporation of amino acids during protein synthesis, leading to dysfunctional proteins and deleterious effects on cellular processes, reducing organismal fitness and causing such mutations to be selected against in natural populations.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Aminoacyl-tRNA Synthetase
Aminoacyl-tRNA synthetases are enzymes that play a crucial role in protein synthesis. They ensure that each tRNA molecule is charged with the correct amino acid. This process is vital for translating the genetic code into proteins. In the case of tRNA, alanine-specific aminoacyl-tRNA synthetase recognizes unique structural features. For example, it identifies the specific G-U base pairing in the tRNA's acceptor stem rather than the anticodon itself. This ensures precision in attaching alanine to its corresponding tRNA. Why is this important?
  • It prevents errors in protein synthesis.
  • It maintains the accuracy and fidelity of the genetic code.
In essence, these synthetases select the correct amino acid without solely relying on the anticodon. This capability contributes significantly to the fidelity of protein synthesis and the overall reliability of the genetic translation process.
Anticodon Mutation
Anticodons are sequences of three bases in tRNA that pair with corresponding codons in mRNA during translation. A mutation in the anticodon can dramatically impact protein synthesis. Let's explore a specific example: a mutation from C to G in the third position of the anticodon in tRNA for alanine. Such a mutation doesn't affect the enzyme's ability to attach alanine to the tRNA. However, it can alter tRNA pairing with mRNA codons during translation. This mismatch could lead to incorrect amino acid incorporation. What are the implications?
  • This may result in proteins with incorrect sequences.
  • Such proteins may lose functionality or gain harmful properties.
Understanding anticodon mutations is critical because even small changes can have significant consequences on cellular function and organismal health.
Protein Synthesis Fidelity
Protein synthesis fidelity refers to the accuracy with which proteins are made according to the information encoded in genes. High fidelity in this process ensures that proteins function correctly and cellular processes run smoothly. Various factors contribute to maintaining fidelity:
  • The accuracy of aminoacyl-tRNA synthetase in charging tRNAs with the right amino acids.
  • The correct pairing of tRNA anticodons with mRNA codons during translation.
Mutations, such as changes in anticodons or mischarging of tRNAs, can undermine this fidelity, leading to potential errors in protein sequences. Such errors might lead to nonfunctional or even harmful proteins. Thus, maintaining high fidelity is essential for the survival and efficiency of cells and entire organisms.
Genetic Code Specificity
The genetic code is a set of rules by which information encoded in DNA or mRNA is translated into proteins by living cells. It is highly specific in translating each set of three nucleotides (codon) into a specific amino acid. Genetic code specificity is crucial for life as it ensures that the correct amino acids are incorporated into proteins. Here's how it works:
  • Each tRNA has a specific anticodon that pairs with its respective mRNA codon.
  • Aminoacyl-tRNA synthetases help ensure that each tRNA is charged with the correct amino acid, protecting the integrity of protein synthesis.
Disruptions in this specificity, such as through mutations or errors in enzyme function, can lead to incorrect protein construction and potentially harmful effects on the organism. Therefore, the specificity of the genetic code is foundational to accurate and reliable protein synthesis.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

Requirements for Protein Translocation across a Membrane The secreted bacterial protein OmpA has a precursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If you denature purified ProOmpA with \(8 \mathrm{M}\) urea and then remove the urea (such as by running the protein solution rapidly through a gel filtration column), the protein can translocate across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if you first incubate ProOmpA for a few hours in the absence of urea. Furthermore, ProOmpA maintains its capacity for translocation for an extended period if you first incubate it in the presence of another bacterial protein called trigger factor. Describe the probable function of trigger factor.

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

Predicting Anticodons from Codons Most amino acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible anticodons for the four codons of glycine: \(\left(5^{\prime}\right) \mathrm{GGU}, \mathrm{GGC}\), GGA, and GGG. a. From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine? b. Which of these anticodon-codon pairings has/have a wobbly base pair? c. In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.