/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 How Many Different mRNA Sequence... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

Short Answer

Expert verified
There are 12 possible mRNA sequences coding for the tripeptide Leu-Met-Tyr.

Step by step solution

01

Understanding Genetic Code

Each amino acid is coded by a sequence of three nucleotides called a codon. Different codons can code for the same amino acid, a property known as 'degeneracy' of the genetic code.
02

Identifying Codons for Leucine (Leu)

Leucine is coded by six different codons: UUA, UUG, CUU, CUC, CUA, and CUG.
03

Identifying Codons for Methionine (Met)

Methionine is coded by a single codon: AUG. This simplifies our calculation for methionine in the sequence.
04

Identifying Codons for Tyrosine (Tyr)

Tyrosine is coded by two codons: UAC and UAU.
05

Calculating Total Possible Combinations

To find the number of different mRNA sequences that can code for the amino acid sequence Leu-Met-Tyr, multiply the number of codons for each amino acid: 6 (Leu) x 1 (Met) x 2 (Tyr). This yields 12 possible mRNA sequences.
06

Listing All Possible mRNA Sequences

- UUA-AUG-UAC - UUA-AUG-UAU - UUG-AUG-UAC - UUG-AUG-UAU - CUU-AUG-UAC - CUU-AUG-UAU - CUC-AUG-UAC - CUC-AUG-UAU - CUA-AUG-UAC - CUA-AUG-UAU - CUG-AUG-UAC - CUG-AUG-UAU

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Amino Acids
Amino acids are the building blocks of proteins, which are essential molecules that perform a variety of functions in living organisms. There are 20 different standard amino acids used by cells to build proteins, each with unique properties. They encode specific functions due to their distinct side chains, which impact how they interact with each other and their environment.

In terms of the genetic code, amino acids are specified by sequences of three nucleotides in DNA or RNA, known as codons. For example, in the exercise provided, the amino acid sequence of Leucine (Leu), Methionine (Met), and Tyrosine (Tyr) is considered for its potential diversity of mRNA sequences.
  • Leucine is represented by six possible codons, showing it's highly flexible within the genetic code.
  • Methionine, meanwhile, has only one codon (AUG), which is unique because it's also the start codon in protein synthesis.
  • Tyrosine can be encoded by two different codons, providing some variation in the genetic code.
mRNA Sequences
Messenger RNA (mRNA) is a type of RNA that serves as a template for protein synthesis. It is synthesized based on the sequence of nucleotides in the DNA and is crucial for conveying the genetic information needed to form proteins.

Once DNA is transcribed into mRNA, this sequence reflects the future protein's blueprint. Each group of three nucleotide bases on mRNA corresponds to one amino acid in the chain. For instance, in our tripeptide of Leucine-Methionine-Tyrosine, the DNA is transcribed into various mRNA sequences. These mRNA sequences are read in sets of three bases called codons, which specify the realization of different amino acids, allowing for multiple mRNA versions that can produce the same protein sequence.
  • It is the mRNA that ultimately guides the synthesis of proteins during a process known as translation.
  • This demonstrates how genetic coding is translated into a physical amino acid sequence by reading the sequences of mRNA codons.
Codons
Codons are vital units of the genetic language composed of triplet nucleotide sequences found in mRNA. Each codon directs the incorporation of a specific amino acid into a growing polypeptide chain during protein synthesis. The genetic code is considered degenerate because several codons can encode the same amino acid.

In the exercise's example, codons for Leucine (Leu) exemplify this degeneracy, where six different codons (UUA, UUG, CUU, CUC, CUA, and CUG) can be used to code for Leucine. Methionine (Met), on the other hand, uses a single codon (AUG), while Tyrosine (Tyr) can be translated from two possible codons (UAC, UAU). This variability allows for robustness in genetic coding and potential error corrections in DNA.
  • Codons play a critical role in ensuring that proteins are synthesized accurately and efficiently.
  • This diversity ensures the protein synthesis machinery can tolerate some mutations without altering protein function.
  • Understanding how different codons translate into amino acids helps illustrate the genetic code's complexity and redundancy.
Polypeptide Synthesis
Polypeptide synthesis is the process by which cells construct proteins from amino acids, following the instructions encoded in the mRNA sequence. It is a central activity in biology that involves transcription and translation.

Transcription is the initial step where DNA's genetic code is copied into mRNA. Translation is where this mRNA is used as a guide to assemble amino acids into a polypeptide chain on ribosomes, the molecular machines responsible for protein assembly. Each codon on the mRNA correlates with specific transfer RNA (tRNA) molecules, which carry the corresponding amino acids and participate in forming the protein sequence.
  • During translation, the mRNA sequence is read step by step, codon by codon, ensuring each amino acid is added correctly to the growing chain.
  • Proteins begin to fold into their specific structures as they are synthesized, which determines their functionality in the organism.
  • Without the precise process of polypeptide synthesis, cells could not produce the proteins necessary for life and biological functions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

The Genetic Code and Mutation A mutation occasionally arises that converts a codon specifying an amino acid to a stop or nonsense codon. When this occurs in the middle of a gene, the resulting protein is truncated and often inactive. If the protein is essential, cell death can result. Which of these secondary mutations might restore some or all of the protein function so that the cell can survive (there may be more than one correct answer)? a. A mutation restoring the codon to one encoding the original amino acid b. A mutation changing the nonsense codon to one encoding a different but similar amino acid c. A mutation in the anticodon of a tRNA such that the tRNA now recognizes the nonsense codon d. A mutation in which an additional nucleotide inserts just upstream of the nonsense codon, changing the reading frame so the nonsense codon is no longer read as "stop"

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Bacterial Protein Export Bacteria mostly use the system shown in Eig \(27-44\) to export proteins out of the cell. SecB, one of the chaperone proteins found only in gram-negative bacteria, delivers a newly translated polypeptide to the SecA ATPase on the interior side of the membrane. SecA pushes the exported protein through a membrane pore formed by the SecYEG complex. The SecYEG complex is homologous to the Sec61 complex in eukaryotes. Which component of this bacterial protein export system would be the most attractive target for antibiotic development? Explain.

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.