Chapter 27: Problem 1
Messenger RNA Translation Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the reading frame begins with the first three bases in each sequence. a. GGUCAGUCGCUCCUGAUU b. UUGGAUGCGCCAUAAUUUGCU c. CAUGAUGCCUGUUGCUAC d. AUGGACGAA
Short Answer
Expert verified
a. Gly-Gln-Ser-Leu-Leu-Ile
b. Leu-Asp-Ala-Pro
c. His-Asp-Ala-Cys-Ala
d. Met-Asp-Glu
Step by step solution
01
Understanding mRNA Codons
Messenger RNA (mRNA) sequences are translated into amino acids using codons, which are groups of three nucleotide bases. Each triplet corresponds to a specific amino acid or a start/stop signal.
02
Codon Table Reference
Use a genetic code table to map mRNA codons to their respective amino acids. This table is crucial as it determines the translation from nucleotides to peptides.
03
Sequence a - GGUCAGUCGCUCCUGAUU
Translate the mRNA codons one by one: GGU (Glycine), CAG (Glutamine), UCG (Serine), CUC (Leucine), CUG (Leucine), AUU (Isoleucine). The resulting peptide is Glycine-Glutamine-Serine-Leucine-Leucine-Isoleucine.
04
Sequence b - UUGGAUGCGCCAUAAUUUGCU
Translate the codons: UUG (Leucine), GAU (Aspartic Acid), GCG (Alanine), CCA (Proline), UAA (Stop). Translation stops here because UAA is a stop codon. The resulting peptide is Leucine-Aspartic Acid-Alanine-Proline.
05
Sequence c - CAUGAUGCCUGUUGCUAC
Translate the codons: CAU (Histidine), GAU (Aspartic Acid), GCC (Alanine), UGU (Cysteine), GCU (Alanine), the next codon 'AC' is incomplete and cannot be translated. The resulting peptide is Histidine-Aspartic Acid-Alanine-Cysteine-Alanine.
06
Sequence d - AUGGACGAA
Translate the codons: AUG (Methionine), GAC (Aspartic Acid), GAA (Glutamic Acid). There are no stop codons, so the translation continues to the end. The resulting peptide is Methionine-Aspartic Acid-Glutamic Acid.
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
Genetic Code
The genetic code is essentially the set of rules used by living cells to translate information encoded in genetic material, specifically the messenger RNA (mRNA), into proteins. Proteins perform a myriad of functions essential for life. The language of the genetic code is written in sequences of three nucleotides called codons. Each codon specifies a particular amino acid, which are the building blocks of proteins.
It's important to note that the genetic code is nearly universal, which means that almost all organisms use the same codons to code for the same amino acids. This universality underscores the common evolutionary heritage of all living beings.
The genetic code contains 64 codons. Out of these, 61 represent amino acids, while the remaining three are stop signals which mark the end of a protein-coding sequence. The start codon, usually AUG, signals the start of translation and codes for Methionine, which is the first amino acid in many proteins.
It's important to note that the genetic code is nearly universal, which means that almost all organisms use the same codons to code for the same amino acids. This universality underscores the common evolutionary heritage of all living beings.
The genetic code contains 64 codons. Out of these, 61 represent amino acids, while the remaining three are stop signals which mark the end of a protein-coding sequence. The start codon, usually AUG, signals the start of translation and codes for Methionine, which is the first amino acid in many proteins.
Codon Table
A codon table is an essential tool in the translation process. It is essentially a reference chart that biologists use to determine which amino acid corresponds to each codon sequence found in mRNA. Knowing how to use a codon table is crucial for predicting the sequence of amino acids that form proteins.
Here's how it works:
Here's how it works:
- Each mRNA codon is shown in the table. For example, the codon "AUG" will correspond to the amino acid Methionine.
- The table is organized in a manner that the first, second, and third nucleotides of the codon help locate the specific amino acid in the table. Reading these three bases in order will lead you to the correct entry in the table.
- Codon tables also include stop codons, such as UAA, which signal the end of a protein chain.
Amino Acid Sequence
An amino acid sequence is the order in which amino acids are linked together to form a protein. Once mRNA is transcribed from DNA, ribosomes in the cell translate the mRNA into a chain of amino acids, resulting in protein synthesis.
Proteins are made by linking together specific sequences of amino acids, and this sequence determines the protein's structure and function. The sequence is crucial because even a small change in the order of amino acids can significantly impact protein function and overall organism health.
To derive an amino acid sequence from mRNA, one must follow these steps:
Proteins are made by linking together specific sequences of amino acids, and this sequence determines the protein's structure and function. The sequence is crucial because even a small change in the order of amino acids can significantly impact protein function and overall organism health.
To derive an amino acid sequence from mRNA, one must follow these steps:
- Using the codon table, identify the amino acid for each codon triplet in the mRNA.
- Translate the sequence starting from the start codon, usually AUG.
- Continue translation until you hit a stop codon, which indicates the chain is complete.