/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 1 Messenger RNA Translation Predic... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Messenger RNA Translation Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the reading frame begins with the first three bases in each sequence. a. GGUCAGUCGCUCCUGAUU b. UUGGAUGCGCCAUAAUUUGCU c. CAUGAUGCCUGUUGCUAC d. AUGGACGAA

Short Answer

Expert verified
a. Gly-Gln-Ser-Leu-Leu-Ile b. Leu-Asp-Ala-Pro c. His-Asp-Ala-Cys-Ala d. Met-Asp-Glu

Step by step solution

01

Understanding mRNA Codons

Messenger RNA (mRNA) sequences are translated into amino acids using codons, which are groups of three nucleotide bases. Each triplet corresponds to a specific amino acid or a start/stop signal.
02

Codon Table Reference

Use a genetic code table to map mRNA codons to their respective amino acids. This table is crucial as it determines the translation from nucleotides to peptides.
03

Sequence a - GGUCAGUCGCUCCUGAUU

Translate the mRNA codons one by one: GGU (Glycine), CAG (Glutamine), UCG (Serine), CUC (Leucine), CUG (Leucine), AUU (Isoleucine). The resulting peptide is Glycine-Glutamine-Serine-Leucine-Leucine-Isoleucine.
04

Sequence b - UUGGAUGCGCCAUAAUUUGCU

Translate the codons: UUG (Leucine), GAU (Aspartic Acid), GCG (Alanine), CCA (Proline), UAA (Stop). Translation stops here because UAA is a stop codon. The resulting peptide is Leucine-Aspartic Acid-Alanine-Proline.
05

Sequence c - CAUGAUGCCUGUUGCUAC

Translate the codons: CAU (Histidine), GAU (Aspartic Acid), GCC (Alanine), UGU (Cysteine), GCU (Alanine), the next codon 'AC' is incomplete and cannot be translated. The resulting peptide is Histidine-Aspartic Acid-Alanine-Cysteine-Alanine.
06

Sequence d - AUGGACGAA

Translate the codons: AUG (Methionine), GAC (Aspartic Acid), GAA (Glutamic Acid). There are no stop codons, so the translation continues to the end. The resulting peptide is Methionine-Aspartic Acid-Glutamic Acid.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genetic Code
The genetic code is essentially the set of rules used by living cells to translate information encoded in genetic material, specifically the messenger RNA (mRNA), into proteins. Proteins perform a myriad of functions essential for life. The language of the genetic code is written in sequences of three nucleotides called codons. Each codon specifies a particular amino acid, which are the building blocks of proteins.
It's important to note that the genetic code is nearly universal, which means that almost all organisms use the same codons to code for the same amino acids. This universality underscores the common evolutionary heritage of all living beings.
The genetic code contains 64 codons. Out of these, 61 represent amino acids, while the remaining three are stop signals which mark the end of a protein-coding sequence. The start codon, usually AUG, signals the start of translation and codes for Methionine, which is the first amino acid in many proteins.
Codon Table
A codon table is an essential tool in the translation process. It is essentially a reference chart that biologists use to determine which amino acid corresponds to each codon sequence found in mRNA. Knowing how to use a codon table is crucial for predicting the sequence of amino acids that form proteins.
Here's how it works:
  • Each mRNA codon is shown in the table. For example, the codon "AUG" will correspond to the amino acid Methionine.
  • The table is organized in a manner that the first, second, and third nucleotides of the codon help locate the specific amino acid in the table. Reading these three bases in order will lead you to the correct entry in the table.
  • Codon tables also include stop codons, such as UAA, which signal the end of a protein chain.
Using a codon table, scientists and students alike can translate mRNA sequences into their respective proteins rapidly, assisting with experiments and educational exercises.
Amino Acid Sequence
An amino acid sequence is the order in which amino acids are linked together to form a protein. Once mRNA is transcribed from DNA, ribosomes in the cell translate the mRNA into a chain of amino acids, resulting in protein synthesis.
Proteins are made by linking together specific sequences of amino acids, and this sequence determines the protein's structure and function. The sequence is crucial because even a small change in the order of amino acids can significantly impact protein function and overall organism health.
To derive an amino acid sequence from mRNA, one must follow these steps:
  • Using the codon table, identify the amino acid for each codon triplet in the mRNA.
  • Translate the sequence starting from the start codon, usually AUG.
  • Continue translation until you hit a stop codon, which indicates the chain is complete.
This sequential translation forms the backbone of protein synthesis, ensuring the right proteins are constructed to carry out vital cellular functions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Importance of the "Second Genetic Code" Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. a. What features of tRNA \(^{\text {Ala }}\) does Ala-tRNA synthetase recognize? b. Describe the consequences of a \(\mathrm{C} \rightarrow \mathrm{G}\) mutation in the third position of the anticodon of \(\mathrm{tRNA}^{\mathrm{Ala}}\). c. What other kinds of mutations might have similar effects? d. Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.)

The Genetic Code and Mutation A mutation occasionally arises that converts a codon specifying an amino acid to a stop or nonsense codon. When this occurs in the middle of a gene, the resulting protein is truncated and often inactive. If the protein is essential, cell death can result. Which of these secondary mutations might restore some or all of the protein function so that the cell can survive (there may be more than one correct answer)? a. A mutation restoring the codon to one encoding the original amino acid b. A mutation changing the nonsense codon to one encoding a different but similar amino acid c. A mutation in the anticodon of a tRNA such that the tRNA now recognizes the nonsense codon d. A mutation in which an additional nucleotide inserts just upstream of the nonsense codon, changing the reading frame so the nonsense codon is no longer read as "stop"

Protein-Coding Capacity of a Viral DNA The \(5,386 \mathrm{bp}\) genome of bacteriophage \(\phi \times 174\) includes genes for 10 proteins, designated A to \(\mathrm{K}\) (omitting "I"), with sizes given in the table. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the \(\phi \mathrm{X} 174\) genome with its protein-coding capacity? \begin{tabular}{ccc} Protein & Number of amino acid residues & Protein & Number of amino acid residues \\ \hline \end{tabular} \begin{array}{llll} \text { A } & 455 & 427 \\ \text { B } & 120 & \text { F } & 175 \\ \text { C } & 86 & \text { H } & 328 \\ \text { D } & 152 & \text { J } & 38 \\ \text { E } & 91 & \text { K } & 56 \\ \hline \end{array}

Proofreading by Aminoacyl-tRNA Synthetases The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

Synthetic mRNAs The genetic code was elucidated through the use of polyribonucleotides synthesized either enzymatically or chemically in the laboratory. Given what we now know about the genetic code, how would you make a polyribonucleotide that could serve as an mRNA coding predominantly for many Phe residues and for a small number of Leu and Ser residues? What other amino acid(s) would be encoded by this polyribonucleotide, but in smaller amounts?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.