/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 Proofreading by Aminoacyl-tRNA S... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Proofreading by Aminoacyl-tRNA Synthetases The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

Short Answer

Expert verified
Isoleucyl-tRNA synthetase corrects misattachments with proofreading; histidyl-tRNA synthetase relies on active site precision.

Step by step solution

01

Understanding the Role of Aminoacyl-tRNA Synthetases

Aminoacyl-tRNA synthetases are enzymes responsible for attaching the correct amino acids to their corresponding tRNA molecules, a crucial step in protein synthesis that ensures the translation of the genetic code with high accuracy.
02

Exploring Proofreading in Isoleucyl-tRNA Synthetase

Isoleucyl-tRNA synthetase possesses a proofreading mechanism that detects and corrects errors if incorrect amino acids get attached. This proofreading involves hydrolysis of incorrectly paired aminoacyl-tRNA before it participates in protein synthesis, ensuring only isoleucine is added.
03

Examining Histidyl-tRNA Synthetase's Lack of Proofreading

Unlike isoleucyl-tRNA synthetase, histidyl-tRNA synthetase does not have a proofreading function. The selection between histidine and its structurally similar but distinct amino acids is mostly achieved by precise active site architecture.
04

Analyzing Why Precision Might Vary Between Enzymes

The need for proofreading depends on the chemical similarity of the potential errors (amino acids) and the critical nature of the amino acid in protein function. The natural abundance and structural uniqueness of histidine compared to its near analogs may reduce the likelihood of errors that necessitate proofreading.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Proofreading Mechanisms
Proofreading mechanisms are essential cellular processes that ensure the accuracy of biological operations, specifically in protein synthesis. Within the realm of aminoacyl-tRNA synthetases, proofreading refers to the ability of an enzyme to verify and correct the attachment of amino acids to their corresponding tRNA molecules.
Think of proofreading as a quality checkpoint. A mistake in pairing could lead to incorrect proteins, which may not function properly or could even be harmful. This mechanism is particularly critical when the amino acids involved in the synthesis have slight structural similarities.
  • The mechanism helps recognize an incorrectly attached amino acid.
  • It then performs hydrolysis to remove this wrong amino acid.
  • Finally, it reattempts the correct amino acid attachment.
This system ensures that only the correct aminoacyl-tRNA molecules participate in protein synthesis, maintaining high fidelity in genetic translation.
Protein Synthesis
Protein synthesis is a fundamental biological process that translates genetic information into functional proteins. This process occurs in all living cells and involves two primary steps: transcription and translation. In translation, aminoacyl-tRNA synthetases play an instrumental role by linking amino acids to their respective tRNA, thus preparing them for inclusion in the growing protein chain.
The process follows these basic steps:
  • tRNA molecules, each specific for one amino acid, transport their corresponding amino acids to the ribosome, where protein synthesis occurs.
  • Aminoacyl-tRNA synthetases charge tRNA molecules by attaching the correct amino acids.
  • This charged tRNA enters the ribosome, where its anticodon pairs with the corresponding mRNA codon sequence, adding the respective amino acid to the peptide chain.
This precision-driven activity is orchestrated by the meticulous work of various synthetases, ensuring proteins are constructed accurately according to the genetic blueprint.
Isoleucyl-tRNA Synthetase
Isoleucyl-tRNA synthetase is one of the specific synthetase enzymes that demonstrate proofreading capabilities. It has an essential role in ensuring that the amino acid isoleucine is accurately attached to its corresponding tRNA, a task made more complex because of its structurally similar amino acids such as valine.
Here is how it performs these duties:
  • The enzyme first catalyzes the attachment of an amino acid to the tRNA.
  • It then uses a proofreading mechanism to check for errors.
  • If a non-isoleucine amino acid, like valine, is mistakenly attached, the enzyme detects this discrepancy.
  • The incorrect amino acid undergoes hydrolysis, removing it from the tRNA.
  • The process retries until isoleucine is correctly linked to the tRNA.
This robust error-checking process ensures that only the correct amino acid participates in the synthesis of proteins, thus maintaining the integrity of physiological functions.
Histidyl-tRNA Synthetase
Histidyl-tRNA synthetase operates differently compared to isoleucyl-tRNA synthetase, primarily in that it does not possess a proofreading function. Despite lacking this feature, it accurately selects histidine to attach to its respective tRNA.
This can be attributed to:
  • The distinct active site setup that provides high specificity for histidine.
  • The lower likelihood of confusing histidine with other amino acids, given its unique structure.
  • The natural balancing act of selectivity versus flexibility within the enzyme's active site architecture.
These factors lessen the necessity of a proofreading function because histidine's distinct molecular traits reduce the risk of incorrect amino acid attachment. Therefore, histidyl-tRNA synthetase can maintain the synthesis of accurate proteins without employing a traditional proofreading mechanism.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

Messenger RNA Translation Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the reading frame begins with the first three bases in each sequence. a. GGUCAGUCGCUCCUGAUU b. UUGGAUGCGCCAUAAUUUGCU c. CAUGAUGCCUGUUGCUAC d. AUGGACGAA

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the \(\beta\)-globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.