/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 3 Can the Base Sequence of an mRNA... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

Short Answer

Expert verified
No, the mRNA sequence cannot be uniquely predicted due to the degeneracy of the genetic code.

Step by step solution

01

Understanding the Problem

To predict the base sequence of an mRNA from an amino acid sequence, we must consider how amino acids are encoded. Each amino acid is coded by one or more codons, which are sequences of three nucleotides in the mRNA.
02

The Genetic Code Table

The genetic code is degenerate, meaning multiple codons can specify a single amino acid. For example, both AUG and ATG codons encode the amino acid methionine.
03

Decoding the Amino Acid Sequence

Given an amino acid sequence, identify all possible codons that could encode each amino acid. Since the genetic code is degenerate, there will be multiple options for the mRNA sequence corresponding to even a single amino acid.
04

Considering Variability

Due to the degeneracy of the genetic code, there are multiple valid mRNA sequences that can produce the same polypeptide chain. This variability makes it impossible to uniquely predict a single mRNA sequence for a given protein.
05

Conclusion

Because different sequences of bases can code for the same sequence of amino acids, the base sequence of an mRNA cannot be uniquely determined from the amino acid sequence of its polypeptide product.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genetic Code
The genetic code is a set of rules that defines how the information in our DNA is translated into proteins. It's a map that links specific sequences of three nucleotides, known as codons, with specific amino acids. This is how the genetic information in a cell gets converted into functional products. In essence, the genetic code takes the language of nucleic acids and translates it into the language of proteins, which are made up of amino acids. The order of the nucleotides determines the order in which amino acids are linked together to form a protein.
Understanding the genetic code is essential because it provides the instructions for building all proteins in an organism. This code is almost universal, meaning that nearly all organisms use the same codons to encode the same amino acids. This universality reflects the shared evolutionary history of life on Earth, highlighting the fundamental nature of the genetic code.
Amino Acid Sequence
The amino acid sequence of a protein is crucial because it determines the protein's structure and, ultimately, its function. Proteins are built from 20 different amino acids, and the sequence in which they are arranged is specified by the sequence of nucleotides in the mRNA. Even a small change in the amino acid sequence can greatly affect a protein’s function, which is why this sequence is so important.
When the mRNA is translated, ribosomes create a peptide chain by linking amino acids in the order specified. This process involves reading the mRNA sequence in sets of three nucleotides, or codons. Each codon corresponds to one of the 20 amino acids or a stop signal, which indicates the end of protein synthesis. Understanding an amino acid sequence can help in predicting the structure and function of a protein but not the exact mRNA sequence that encoded it due to the degeneracy of the genetic code.
Codons
Codons are sequences of three nucleotides found in mRNA that correspond to specific amino acids or stop signals during protein synthesis. Each triplet of bases codes for one of the 20 amino acids, providing the instructions for building proteins. For example, the codon AUG codes for methionine, which often acts as the start signal for protein synthesis.
The redundancy of the genetic code means that most amino acids are encoded by more than one codon. This feature is known as the degeneracy of the genetic code and is crucial for understanding why it is challenging to predict an mRNA sequence from an amino acid sequence. For instance, the amino acid leucine can be encoded by any of six different codons, making it tricky to pinpoint the exact mRNA sequence from protein data alone.
Degeneracy of Genetic Code
The degeneracy of the genetic code refers to the fact that multiple codons can encode the same amino acid. This feature of the genetic code adds a layer of complexity when trying to decode genetic information backward, from a protein's amino acid sequence to the mRNA sequence.
The primary advantage of this degeneracy is error tolerance in protein synthesis. Mistakes during DNA replication or mRNA transcription can occur, but the redundancy helps minimize their effects by increasing the chances that the resulting protein is still functional. Degeneracy is why different mRNA sequences can produce the same protein product; this "fall-back" helps organisms adapt and thrive despite mutations. While advantageous for stability, this characteristic makes it impossible to determine a single, unique mRNA sequence from a given amino acid sequence, which is why multiple sequences can lead to the same final protein product.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Protein-Coding Capacity of a Viral DNA The \(5,386 \mathrm{bp}\) genome of bacteriophage \(\phi \times 174\) includes genes for 10 proteins, designated A to \(\mathrm{K}\) (omitting "I"), with sizes given in the table. How much DNA would be required to encode these 10 proteins? How can you reconcile the size of the \(\phi \mathrm{X} 174\) genome with its protein-coding capacity? \begin{tabular}{ccc} Protein & Number of amino acid residues & Protein & Number of amino acid residues \\ \hline \end{tabular} \begin{array}{llll} \text { A } & 455 & 427 \\ \text { B } & 120 & \text { F } & 175 \\ \text { C } & 86 & \text { H } & 328 \\ \text { D } & 152 & \text { J } & 38 \\ \text { E } & 91 & \text { K } & 56 \\ \hline \end{array}

Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and the interior Met residues of polypeptides synthesized by \(E\). coli?

Resistance of the Genetic Code to Mutation The RNA sequence shown represents the beginning of an open reading frame (ORF). What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? (5')AUGAUAUUGCUAUCUUGGACU

The Genetic Code and Mutation A mutation occasionally arises that converts a codon specifying an amino acid to a stop or nonsense codon. When this occurs in the middle of a gene, the resulting protein is truncated and often inactive. If the protein is essential, cell death can result. Which of these secondary mutations might restore some or all of the protein function so that the cell can survive (there may be more than one correct answer)? a. A mutation restoring the codon to one encoding the original amino acid b. A mutation changing the nonsense codon to one encoding a different but similar amino acid c. A mutation in the anticodon of a tRNA such that the tRNA now recognizes the nonsense codon d. A mutation in which an additional nucleotide inserts just upstream of the nonsense codon, changing the reading frame so the nonsense codon is no longer read as "stop"

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.