/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 4 Coding of a Polypeptide by Duple... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG \(\left(3^{\prime}\right)\) a. What is the base sequence of the mRNA that can be transcribed from this strand? b. What amino acid sequence could be coded by the mRNA in (a), starting from the 5 ' end? c. If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

Short Answer

Expert verified
(a) mRNA: GAAUUGUGGGGACUGAAGCGCGGCAGC (5'). (b) Amino acids: Glu-Leu-Trp-Gly-Leu-Lys-Arg-Ala-Gln. (c) No, the nontemplate strand would produce different proteins due to different sequences.

Step by step solution

01

Transcribe the Template DNA to mRNA

To form an mRNA strand from the DNA template strand, use the complementary base pairing rules: replace cytosine (C) with guanine (G), guanine (G) with cytosine (C), adenine (A) with uracil (U), and thymine (T) with adenine (A). The mRNA will have the sequence GAAUUGUGGGGACUGAAGCGCGGCAGC (5').
02

Translate mRNA to an Amino Acid Sequence

Convert the mRNA sequence into an amino acid sequence using the genetic code. Use the 5' to 3' direction, divide into codons (triplets), and find the corresponding amino acid for each codon: GAA - Glutamic Acid (Glu) UUG - Leucine (Leu) UGG - Tryptophan (Trp) GGA - Glycine (Gly) CUG - Leucine (Leu) AAG - Lysine (Lys) CGC - Arginine (Arg) GCG - Alanine (Ala) CAG - Glutamine (Gln) C - incomplete as it doesn't complete a codon (stop here for purpose of answer) Thus, the sequence is: Glu-Leu-Trp-Gly-Leu-Lys-Arg-Ala-Gln.
03

Analyze the Complementary Strand Coding Potential

If the complementary (nontemplate) strand 5'-GACGGCGCGAAGTCAGGGGTGTTAAG-3' is transcribed into mRNA (replacing T with U), it would produce the sequence 5'-CUGCCGCGCUUCAGUCCCCACAAUUC-3'. This is reverse and not the same code as the original direction mRNA was derived, therefore different amino acids would be produced, confirming the importance of template strand specificity in DNA coding.
04

Explain Biological Significance

The biological significance lies in the fact that the template and nontemplate strands of DNA encode different sequences. The template strand is precisely needed for mRNA synthesis, and translating the mRNA from the template strand ensures accurate protein production. Misalignment by using a non-template strand would produce different proteins, potentially leading to cellular dysfunction or no function at all.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

mRNA synthesis
During the process of mRNA synthesis, also known as transcription, the DNA template strand is crucial. This is because it provides the pattern necessary to assemble a complementary RNA sequence.
The DNA sequence has nucleotides that pair with specific ribonucleotides to form messenger RNA (mRNA).
In this process, adenine pairs with uracil (A-U), and cytosine pairs with guanine (C-G). Thymine in the DNA strand is replaced by adenine (T-A) in the RNA.
  • mRNA synthesis occurs in the 5' to 3' direction.
  • It requires the enzyme RNA polymerase, which helps in creating a single strand of RNA.
  • This mRNA then carries the genetic information from the nucleus to the ribosome.
genetic code
The genetic code is like a language that translates the mRNA sequence into a protein sequence. It consists of codons, which are sequences of three nucleotides.
Each codon codes for a specific amino acid, the building blocks of proteins.
  • The genetic code is universal, which means it is the same in almost all organisms.
  • It is also redundant; some amino acids are encoded by more than one codon.
  • For instance, both the codons GAA and GAG code for the amino acid glutamic acid.
The mRNA is read sequentially in sets of three bases, and this sequence dictates the resulting protein's composition.
amino acid sequence
An amino acid sequence is the order in which amino acids are linked together to form a protein. Proteins are essential for many biological processes, and their function is determined by their amino acid sequence.
The sequence is determined by the mRNA, which acts as a template for protein synthesis.
  • During translation, the ribosome reads the mRNA in codons, starting from the 5' end.
  • Each codon corresponds to a specific amino acid.
  • The sequence of amino acids that line up according to the codons results in a polypeptide chain, forming a functional protein.
template strand
The template strand is one of the two strands in a DNA double helix and acts as the blueprint for mRNA synthesis. This strand contains the actual code needed to make proteins.
  • When transcribing, the template strand provides the sequence, ensuring that mRNA is accurately synthesized.
  • The enzyme RNA polymerase moves along the template strand from 3' to 5’ direction, helping synthesize mRNA from 5' to 3'.
  • The template strand is crucial because a small error could lead to the synthesis of a faulty protein.
The accuracy of the template strand in its role ensures the correct genetic information is conveyed to the mRNA.
nontemplate strand
The nontemplate strand, sometimes called the coding strand, is not used during transcription but resembles the mRNA sequence produced. While it looks structurally similar to the resulting mRNA, it is actually not the strand from which mRNA is directly synthesized.
  • The nontemplate strand is the opposite of the template strand.
  • Its sequence is complementary to the template strand but similar to the mRNA (except thymine is replaced with uracil).
  • Despite not being used to produce mRNA, the nontemplate strand helps researchers and scientists predict mRNA and protein sequences.
Misinterpreting the role of the nontemplate strand can lead to errors in understanding genetic coding and protein synthesis.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the \(\beta\)-globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

Predicting Anticodons from Codons Most amino acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible anticodons for the four codons of glycine: \(\left(5^{\prime}\right) \mathrm{GGU}, \mathrm{GGC}\), GGA, and GGG. a. From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine? b. Which of these anticodon-codon pairings has/have a wobbly base pair? c. In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

Can the Base Sequence of an mRNA Be Predicted from the Amino Acid Sequence of Its Polypeptide Product? A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c\), can we predict the base sequence of the unique mRNA that encoded it? Give reasons for your answer.

How Many Different mRNA Sequences Can Specify One Amino Acid Sequence? Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea of the number of possible mRNAs that can code for one polypeptide.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.