/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 18 The Role of Translation Factors ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The Role of Translation Factors A researcher isolates mutant variants of the bacterial translation factors IF2, EFTu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Short Answer

Expert verified
Translation is blocked at initiation by IF2 mutation, elongation (aminoacyl-tRNA delivery) by EFTu mutation, and elongation (translocation) by EF-G mutation.

Step by step solution

01

Understanding Translation Factors

Translation factors IF2, EFTu, and EF-G play crucial roles in the initiation, elongation, and termination processes of protein synthesis in bacteria. Both IF2 and EF-G are involved in GTP hydrolysis, which allows them to perform specific functions during translation.
02

Analyzing the Role of IF2

IF2 is a factor mainly involved in the initiation phase of translation. It helps in the formation of the initiation complex by facilitating the attachment of the initiator tRNA to the small ribosomal subunit. GTP hydrolysis is essential for IF2 to leave the complex, allowing the large ribosomal subunit to join and form the initiation complex.
03

Determining the Impact of Non-Hydrolyzed GTP on IF2

If the GTP on IF2 is not hydrolyzed due to the mutation, IF2 cannot leave the complex, and thus the large ribosomal subunit cannot join. Translation would be blocked at the initiation stage, preventing the formation of the complete ribosome on the mRNA.
04

Examining the Role of EFTu

EFTu is responsible for delivering aminoacyl-tRNAs to the A site of the ribosome during the elongation phase of translation. The proper positioning of the tRNA is aided by EFTu hydrolyzing GTP.
05

Understanding EFTu Mutation Impact

With the inability to hydrolyze GTP, the EFTu will not release the tRNA into the A site even when it matches the mRNA codon. Therefore, translation would be blocked during the elongation phase, specifically at the delivery stage of the tRNA.
06

Exploring the Role of EF-G

EF-G assists in translocating the ribosome along the mRNA by moving the peptidyl-tRNA from the A site to the P site with the help of GTP hydrolysis during elongation.
07

Understanding EF-G Mutation Impact

If EF-G cannot hydrolyze GTP, translocation will not occur, and the ribosome won't shift to allow the next aminoacyl-tRNA to enter. Hence, translation will be blocked during the elongation phase at the translocation step.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Protein Synthesis Initiation
In bacteria, the initiation of protein synthesis is a critical step where the components necessary for translation are assembled. It involves several factors, one of which is the Initiation Factor 2 (IF2). IF2 plays a pivotal role in building the initiation complex. It helps the initiator tRNA bind to the small ribosomal subunit. This is a crucial process because the tRNA needs to accurately pair with the start codon on the mRNA.
For IF2 to function correctly, it requires GTP hydrolysis. Without GTP hydrolysis, IF2 remains stuck with the small ribosomal subunit, preventing the large ribosomal subunit from joining. This blockage effectively halts the initiation and the entire protein synthesis process cannot proceed beyond this point. This shows how essential GTP hydrolysis is for a successful initiation of protein synthesis.
GTP Hydrolysis in Translation
GTP hydrolysis acts as a molecular trigger that catalytic powers several steps of translation in bacteria. It is involved from the very start with Initiation Factor 2 (IF2), to later phases with Elongation Factors Tu (EFTu) and G (EF-G).
  • In IF2, GTP hydrolysis allows the transition from the initiation phase to the elongation phase.
  • For EFTu, GTP hydrolysis releases the aminoacyl-tRNA at the ribosome's A site.
  • Finally, EF-G uses GTP hydrolysis to move the ribosome one step forward along the mRNA.
Any disruption in these hydrolysis events, due to mutation, results in halting translation. This action underlines the indispensability of GTP hydrolysis in making and breaking bonds during the translation process.
Elongation Phase in Translation
The elongation phase of protein synthesis is where amino acids are added sequentially to the growing polypeptide chain. This process relies profoundly on elongation factors like EFTu and EF-G, both of which depend on GTP hydrolysis.
During this phase, EFTu brings the right aminoacyl-tRNA to the ribosome's A site. GTP hydrolysis by EFTu ensures that the tRNA is properly positioned and released if it matches the mRNA codon. In the event of a mutation inhibiting GTP hydrolysis, the tRNA remains bound to EFTu and isn't able to contribute to the growing chain.
After the peptide bond forms between the amino acids, EF-G facilitates the translocation of the ribosome by hydrolyzing GTP. If EF-G fails to hydrolyze GTP, the ribosome cannot move along the mRNA, thus halting the elongation process right in its tracks. Both these actions are essential for proper protein synthesis during elongation.
Translation Blockage due to Mutation
Mutations in the bacterial translation factors can lead to serious disruptions in protein synthesis. The exercise illustrates how changes in key translation factors like IF2, EFTu, and EF-G impede their role by stopping GTP hydrolysis.
  • In IF2's case, mutation blocks the initiation phase by preventing the departure of the initiation complex components.
  • With EFTu, mutation results in failure of the aminoacyl-tRNA to be released properly into the A site.
  • For EF-G, a mutation stops the ribosome from moving forward on the mRNA.
These mutations highlight how critical each factor and GTP hydrolysis is to the functionality of the translation process. Understanding these issues is key to grasping how protein synthesis can be affected by genetic changes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The Genetic Code in Action Translate the mRNA shown, starting at the first 5 ' nucleotide, assuming that translation occurs in an \(E\). coli cell. If all tRNAs make maximum use of wobble rules but do not contain inosine, how many distinct tRNAs are required to translate this RNA? (5) AUGGGUCGUGAGUCAUCGUUAAU

Methionine Has Only One Codon Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and the interior Met residues of polypeptides synthesized by \(E\). coli?

Effect of Single-Base Changes on Amino Acid Sequence Much important confirmatory evidence on the genetic code has come from assessing changes in the amino acid sequence of mutant proteins after a single base has been changed in the gene that encodes the protein. Which of the listed amino acid replacements would be consistent with the genetic code if the replacements were caused by a single base change? Which cannot be the result of a single- base mutation? Why? a. Phe \(\rightarrow\) Leu b. Lys \(\rightarrow\) Ala c. Ala \(\rightarrow\) Thr d. Phe \(\rightarrow\) Lys e. Ile \(\rightarrow\) Leu f. His \(\rightarrow\) Glu g. Pro \(\rightarrow\) Ser

Basis of the Sickle Cell Mutation Sickle cell hemoglobin has a Val residue at position 6 of the \(\beta\)-globin chain instead of the Glu residue found in normal hemoglobin A. Can you predict what change took place in the DNA codon for glutamate to account for replacement of the Glu residue by Val?

Requirements for Protein Translocation across a Membrane The secreted bacterial protein OmpA has a precursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If you denature purified ProOmpA with \(8 \mathrm{M}\) urea and then remove the urea (such as by running the protein solution rapidly through a gel filtration column), the protein can translocate across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if you first incubate ProOmpA for a few hours in the absence of urea. Furthermore, ProOmpA maintains its capacity for translocation for an extended period if you first incubate it in the presence of another bacterial protein called trigger factor. Describe the probable function of trigger factor.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.