/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 7 Denaturation of Nucleic Acids A ... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 8: Problem 7

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for \(\mathrm{T}\) ) is constructed, will its melting temperature be higher or lower?

Short Answer

Expert verified
The RNA duplex will have a higher melting temperature than the DNA duplex.

Step by step solution

01

Understand Melting Temperature

The melting temperature, \( t_{m} \), is the temperature at which 50% of the DNA strands are in a double-helix with their complementary strand, and 50% are in a "melted" or single-stranded state. This temperature is influenced by factors like strand length, sequence, and the number of hydrogen bonds.
02

Compare DNA and RNA Structures

RNA has a ribose sugar instead of the deoxyribose found in DNA, and uses uracil (U) instead of thymine (T). The presence of the 2'-hydroxyl group in RNA increases the potential for hydrogen bonding and stabilizing the RNA structure.
03

Bonding Differences Between RNA and DNA

RNA-DNA hybridization is more stable in terms of hydrogen bonding, primarily because uracil forms similar bonds to adenine as thymine. However, in a similar sequence, RNA-RNA interactions can produce double helical structures similar to A-form DNA, which is more stable than B-form DNA.
04

Determine the Impact on Melting Temperature

The RNA duplex will likely have a higher melting temperature. This is due to the ribose and the presence of the 2'-hydroxyl group in RNA, which can form extra hydrogen bonds, increasing the stability of the RNA duplex compared to the DNA duplex.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Melting Temperature
The melting temperature, often denoted as \( t_{m} \), is a crucial concept in the study of nucleic acid denaturation. At this temperature, half of the DNA strands become single-stranded, making it a vital indicator of nucleic acid stability. Understanding \( t_{m} \) involves recognizing that it depends on several factors:
  • Strand Length: Longer strands typically have a higher \( t_{m} \) as there are more hydrogen bonds and stacking interactions to break.
  • Base Composition: GC pairs, with three hydrogen bonds, contribute more to stability than AT pairs, which have only two hydrogen bonds.
  • Sequence Complexity: Certain sequences with high GC content or repetitive patterns can lead to higher \( t_{m} \).
The melting point reflects the balance of these forces, illustrating why it's critical to consider when comparing nucleic acid stability.
DNA vs RNA Stability
When comparing DNA and RNA, several structural differences account for variations in their stability.
  • Sugar Component: DNA's deoxyribose is more stable than RNA's ribose due to the lack of a 2'-hydroxyl group, making RNA more reactive but also more prone to hydrolysis.
  • Nucleobase Variability: RNA uses uracil in place of thymine. While they bond similarly to adenine, uracil is slightly less stable chemically compared to thymine.
  • Hydrogen Bonding: The presence of the 2'-hydroxyl group in RNA contributes to additional hydrogen bonding potential, which can enhance RNA duplex stability.
Due to these factors, RNA structures can often be more stable in comparative contexts, especially given their tendency to form A-form helices that are more tightly coiled and compact than DNA's B-form helix.
Hydrogen Bonding in Nucleic Acids
Hydrogen bonds are the key to understanding the stability of nucleic acid structures like DNA and RNA. These bonds contribute significantly to the pairing of complementary bases鈥攁denine with thymine (or uracil in RNA) and guanine with cytosine.

Influence on Stability

  • GC pairs, with their three hydrogen bonds, are more stable than AT or AU pairs, which have only two hydrogen bonds.
  • The additional hydrogen bonding possibilities in RNA are due to the 2'-hydroxyl group, which not only participates in hydrogen bonds but also helps in forming non-canonical interaction such as Hoogsteen base pairing.
Hydrogen bonds are crucial in defining the melting temperature and overall stability of nucleic acid duplexes, ultimately affecting how DNA and RNA behave under heat and stress.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double- stranded DNA have the potential to form any alternative structures?

Preserving DNA in Bacterial Endospores Bacterial endospores form when the environment is no longer conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. \(B\). subtilis spores are much more resistant than are the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations. (a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations? (b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

The Structure of DNA Elucidation of the three-dimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.pdb.org). Use the PDB identifiers listed below to retrieve the structure surnuraries for the two forms of DNA. Open the structures using Jmol, and use the controls in the Jmol menu (accessed with a control-click or by clicking on the Jmol logo in the lower right corner of the image screen) to complete the following exercises. Refer to the Jmol help links as needed. (a) Obtain the file for \(141 \mathrm{D}\), a highly conserved, repeated DNA sequence from the end of the HIV-1 (the virus that causes AIDS) genome. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Identify the \(5^{\prime}\) end of each strand. Locate the major and minor grooves. Is this a right- or left-handed helix? (b) Obtain the file for \(145 \mathrm{D}\), a DNA with the \(\mathrm{Z}\) conformation. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix? (c) To fully appreciate the secondary structure of DNA, view the molecules in stereo. On the control menu, Select \(>\) All, then Style \(>\) Stereographic \(>\) Cross-eyed viewing or Wall-eyed viewing. (If you have stereographic glasses available, select the appropriate option.) You will see two images of the DNA molecule. Sit with your nose approximately 10 inches from the monitor and focus on the tip of your nose (cross-eyed) or the opposite edges of the screen (wall-eyed). In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three-dimensional. (Note that only one of the two authors can make this work.)

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G}=\mathrm{C}(\text { not } \mathrm{A}=\mathrm{T})\) base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

Snake Venom Phosphodiesterase An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the \(3^{\prime}\) end of any oligonucleotide with a free \(3^{\prime}\) -hydroxyl group, cleaves between the \(3^{\prime}\) hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single- stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are the products of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the following sequence? $$\left(5^{\prime}\right) \text { GCGCCAUUGC }\left(3^{\prime}\right)-\mathrm{OH}$$
See all solutions

Recommended explanations on Chemistry Textbooks

Chemical Analysis

Read Explanation

Inorganic Chemistry

Read Explanation

Chemistry Branches

Read Explanation

Physical Chemistry

Read Explanation

The Earths Atmosphere

Read Explanation

Organic Chemistry

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.