/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 Base Sequence of Complementary D... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double- stranded DNA have the potential to form any alternative structures?

Short Answer

Expert verified
The complementary strand is (3') CGCGTTATAAAGAGTTTTATAACGCG (5'). The sequence is palindromic and can form alternative structures.

Step by step solution

01

Understanding DNA Base Pairing

DNA consists of two strands forming a double helix. The base pairing rules are that adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). Accordingly, each base on one strand forms a hydrogen bond with its complement on the opposite strand.
02

Determine the Directionality

The given strand is labeled with directionality, indicated by \(5'\) at the start and \(3'\) at the end. The complementary strand will run in the opposite direction, from \(3'\) to \(5'\). This means we will write the complementary sequence starting from the 3' end on the left.
03

Writing the Complementary Sequence

Starting from the 3' end of the complementary strand: pair G with C, C with G, G with C, C with G, A with T, A with T, T with A, T with A, T with A, C with G, T with A, C with G, A with T, A with T, A with T, T with A, A with T, T with A, T with A, G with C, C with G, G with C, C with G. The completed complementary sequence becomes \(3'\)CGCGTTATAAAGAGTTTTATAACGCG(5').
04

Identify the Special Type of Sequence

This segment of the DNA strand is a palindrome. A palindromic DNA sequence is a region where the sequence of bases reads the same both forwards and backwards when considering each strand's 5' to 3' directionality.
05

Analyze for Alternative Structures

Palindromic sequences have the potential to form hairpin structures or cruciform structures in DNA due to their symmetry. The complementary strand has such properties that could allow for alternative conformations or secondary structures to form under specific conditions.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Complementary DNA Strands
Complementary DNA strands are essential in maintaining the double helical structure of DNA. These strands are composed of sequences where the bases on one strand pair with complementary bases on the opposite strand. According to the rules of base pairing, guanine (G) pairs with cytosine (C), and adenine (A) pairs with thymine (T). This pairing occurs through hydrogen bonds: G-C pairs have three hydrogen bonds, whereas A-T pairs have two, contributing to the stability of the DNA molecule.
When determining the sequence of a complementary strand, it is crucial to consider the directionality of the strands. DNA strands run antiparallel, meaning if one strand runs from 5' to 3', the complementary strand will run from 3' to 5'.
In the given exercise, the DNA sequence provided is read from the 5' to 3' direction, and its complement is determined in the opposite 3' to 5' direction. The result of the pairing process grants us the complementary strand: CGCGTTATAAAGAGTTTTATAACGCG.
Palindromic DNA Sequence
A palindromic DNA sequence is a segment of DNA where reading the bases in both directions yields the same sequence when considering each strand's directionality. This unique feature means that the sequence on one strand complements and mirrors the sequence on the opposite strand.
Palindromes in DNA are noteworthy because they can produce special structural formations. These structures occur when the DNA folds back onto itself, creating configurations like cruciforms or hairpins. This folding is often facilitated in regions with repetitive sequences, which enhance the symmetrical nature necessary for such structures.
In the context of the given exercise, the DNA segment provided is identified as palindromic. Thus this segment can potentially enable unique spatial arrangements due to its mirroring nature over respective strands.
Alternative DNA Structures
DNA's flexibility allows it to adopt various conformations beyond the classic double helix. Alternative DNA structures arise from sequences like palindromes, or due to specific environmental conditions that affect strand stability or interaction.
A common alternative structure that can emerge from palindromic sequences is the hairpin loop. This structure forms when inverted repeats within a single strand pair with each other, creating a loop out of the unpaired bases. Another possible structure is the cruciform, where both DNA strands form hairpin loops, leading to a cross-like shape.
These formations can play significant roles in biological processes like gene regulation and replication, as they can introduce bends or other changes in the DNA that affect how proteins interact with it. The exercise mentions that the palindromic nature of the sequence introduces the potential for such alternative structures, suggesting the importance of palindromes in expanding DNA's functional versatility.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Preserving DNA in Bacterial Endospores Bacterial endospores form when the environment is no longer conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. \(B\). subtilis spores are much more resistant than are the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations. (a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations? (b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

Sanger Sequencing Logic In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide triphosphate- say, ddCTP- is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What result. would be observed if the dCTP were omitted?

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for \(\mathrm{T}\) ) is constructed, will its melting temperature be higher or lower?

The Structure of DNA Elucidation of the three-dimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.pdb.org). Use the PDB identifiers listed below to retrieve the structure surnuraries for the two forms of DNA. Open the structures using Jmol, and use the controls in the Jmol menu (accessed with a control-click or by clicking on the Jmol logo in the lower right corner of the image screen) to complete the following exercises. Refer to the Jmol help links as needed. (a) Obtain the file for \(141 \mathrm{D}\), a highly conserved, repeated DNA sequence from the end of the HIV-1 (the virus that causes AIDS) genome. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Identify the \(5^{\prime}\) end of each strand. Locate the major and minor grooves. Is this a right- or left-handed helix? (b) Obtain the file for \(145 \mathrm{D}\), a DNA with the \(\mathrm{Z}\) conformation. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix? (c) To fully appreciate the secondary structure of DNA, view the molecules in stereo. On the control menu, Select \(>\) All, then Style \(>\) Stereographic \(>\) Cross-eyed viewing or Wall-eyed viewing. (If you have stereographic glasses available, select the appropriate option.) You will see two images of the DNA molecule. Sit with your nose approximately 10 inches from the monitor and focus on the tip of your nose (cross-eyed) or the opposite edges of the screen (wall-eyed). In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three-dimensional. (Note that only one of the two authors can make this work.)

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.