/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Lehninger Principles of Biochemistry Chapter 8 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 1

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Problem 2

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double- stranded DNA have the potential to form any alternative structures?

Problem 3

DNA of the Human Body Calculate the weight in grams of a double-helical DNA molecule stretching from the Earth to the moon \((\sim 320,000 \mathrm{km}) .\) The DNA double helix weighs about \(1 \times 10^{-18}\) gper 1,000 nucleotide pairs; each base pair extends 3.4 A. For an interesting comparison, your body contains about 0.5 g of DNA!

Problem 4

DNA Bending Assume that a poly(A) tract five base pairs long produces a \(20^{\circ}\) bend in a DNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA) \(_{5}\) tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helix.

Problem 6

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G}=\mathrm{C}(\text { not } \mathrm{A}=\mathrm{T})\) base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

Problem 7

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for \(\mathrm{T}\) ) is constructed, will its melting temperature be higher or lower?

Problem 10

Nucleic Acid Structure Explain why the absorption of UV light by double- stranded DNA increases (the hyperchromic effect \()\) when the DNA is denatured.

Problem 12

Solubility of the Components of DNA Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimen- sional structure of double-stranded DNA?

Problem 13

Sanger Sequencing Logic In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide triphosphate- say, ddCTP- is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What result. would be observed if the dCTP were omitted?

Problem 15

Snake Venom Phosphodiesterase An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the \(3^{\prime}\) end of any oligonucleotide with a free \(3^{\prime}\) -hydroxyl group, cleaves between the \(3^{\prime}\) hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single- stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are the products of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the following sequence? $$\left(5^{\prime}\right) \text { GCGCCAUUGC }\left(3^{\prime}\right)-\mathrm{OH}$$

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks