/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Lehninger Principles of Biochemistry Chapter 27 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 1

Predict the amino acid sequences of peptides formed by ribosomes in response to the following mRNA sequences, assuming that the reading frame begins with the first three bases in each sequence. (a) GGUCAGUCGCUCCUGAUU (b) UUGGAUGCGCCAUAAUUUGCU (c) CAUGAUGCCUGUUGCUAC (d) AUGGACGAA

Problem 2

Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea about the number of possible mRNAs that can code for one polypeptide.

Problem 3

A given sequence of bases in an mRNA will code for one and only one sequence of amino acids in a polypeptide, if the reading frame is specified. From a given sequence of amino acid residues in a protein such as cytochrome \(c,\) can we predict the base sequence of the unique mRNA that coded it? Give reasons for your answer.

Problem 4

The template strand of a segment of double-helical DNA contains the sequence \(\left(5^{\prime}\right)\) CTTAACACCCCTGACTTCGCGCCGTCG(3') (a) What is the base sequence of the mRNA that can be transcribed from this strand? (b) What amino acid sequence could be coded by the mRNA in (a), starting from the \(5^{\prime}\) end? (c) If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

Problem 5

Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and interior Met residues of polypeptides synthesized by \(E\). coli?

Problem 8

Most amino acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible anticodons for the four codons of glycine: \(\left(5^{\prime}\right) \mathrm{GGU}, \mathrm{GGC}, \mathrm{GGA}\) and GGG. (a) From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine? (b) Which of these anticodon-codon pairings has/have a wobbly base pair? (c) In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?

Problem 10

The following RNA sequence represents the beginning of an open reading frame. What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? \(\left(5^{\prime}\right)\) AUGAUAUUGCUAUCUUGGACU

Problem 12

The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

Problem 13

Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. (a) What features of \(t R N A^{\text {Ala }}\) are recognized by Ala-tRNA synthetase? (b) Describe the consequences of a \(\mathrm{C} \rightarrow \mathrm{G}\) mutation in the third position of the anticodon of tRNA \(^{M_{2}}\) (c) What other kinds of mutations might have similar effects? (d) Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.)

Problem 14

A researcher isolates mutant variants of the bacterial translation factors IF-2, EF-Tu, and EF-G. In each case, the mutation allows proper folding of the protein and the binding of GTP but does not allow GTP hydrolysis. At what stage would translation be blocked by each mutant protein?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks