/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 5 Methionine is one of two amino a... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Methionine is one of two amino acids with only one codon. How does the single codon for methionine specify both the initiating residue and interior Met residues of polypeptides synthesized by \(E\). coli?

Short Answer

Expert verified
Methionine's codon AUG starts translation using formylmethionine and adds regular methionine internally.

Step by step solution

01

Understanding the Codon

Methionine is coded by the single codon AUG in RNA, which is translated into the amino acid methionine during protein synthesis.
02

Role as an Initiating Codon

In the context of protein synthesis initiation in prokaryotes like \( E. \) coli, the AUG codon following a specific sequence known as the Shine-Dalgarno sequence is recognized by the ribosome as the start of translation. This AUG codon specifies the first methionine residue in the polypeptide chain and uses a special form of methionine known as N-formylmethionine (fMet) to start translation.
03

Role as an Interior Methionine

For interior methionine residues within a growing polypeptide chain, the AUG codon simply specifies the addition of a regular methionine to the chain. These interior AUG codons do not use N-formylmethionine, instead, they incorporate standard methionine molecules.
04

Summary Explanation

AUG serves a dual function due to its context within the mRNA. When it is recognized as part of the start site of mRNA, it uses formylmethionine to initiate protein synthesis. But when it appears as a regular codon coding for methionine elsewhere in the mRNA, it incorporates standard methionine.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Amino Acids
Amino acids are the building blocks of proteins and play a crucial role in almost all biological processes. Each amino acid has a specific structure made of an amino group, a carboxyl group, a hydrogen atom, and a unique side chain, all attached to a central carbon atom.
  • There are 20 standard amino acids, which combine in various sequences to form proteins.
  • Methionine is one of these amino acids and is unique because it is often the starting amino acid in the synthesis of proteins in cells.
  • This role during protein synthesis makes methionine significant for initiating the translation process, particularly in prokaryotic organisms like E. coli.
Understanding the role of amino acids in protein formation helps grasp the overall process of protein synthesis and its implications in biological systems.
Codons
Codons are sequences of three nucleotides found in messenger RNA (mRNA) that correspond to specific amino acids or stop signals during protein synthesis. These triplets provide the genetic instructions used in the synthesis of proteins.
  • Each codon specifies one of the 20 amino acids or a stop signal during protein synthesis.
  • The AUG codon is of particular importance because it codes for methionine and acts as an initiation signal for translation in many organisms.
  • Interestingly, methionine is one of the few amino acids that is encoded by only one codon, AUG.
The role of codons is essential in translating genetic information into proteins, and understanding how they function provides insight into how proteins are synthesized in cells.
Translation Initiation
Translation initiation is the first stage of protein synthesis where the ribosome assembles around the target mRNA and the first tRNA is attached. This stage is crucial because it sets the reading frame for the ribosome, ensuring the correct sequence of amino acids in the resulting protein.
  • In prokaryotes like E. coli, initiation begins when the ribosome binds to the mRNA at a specific start site.
  • This start site is identified by a sequence called the Shine-Dalgarno sequence, located just upstream of the start codon AUG.
  • Once the AUG is reached, N-formylmethionine is incorporated as the first amino acid, playing a critical role in initiating translation.
Initiation is a tightly regulated process, as starting out correctly is vital for producing functional proteins. By initiating translation appropriately, the cell ensures that the protein is synthesized efficiently and correctly from the very beginning.
Prokaryotic Translation
Prokaryotic translation is the process by which proteins are synthesized within prokaryotic cells like those of E. coli. This process shares similarities with translation in eukaryotes but also has distinct features.
  • Translation in prokaryotes occurs in the cytoplasm and involves the direct interaction of ribosomes with the mRNA.
  • One unique feature is the use of N-formylmethionine as the first amino acid during protein synthesis, distinguishing it from eukaryotic translation where methionine is used without the formyl group.
  • The operon model allows for the simultaneous transcription and translation of multiple genes, which is a hallmark of prokaryotic gene expression.
These characteristics highlight the efficiency and adaptability of prokaryotic translation, enabling rapid protein synthesis in response to environmental changes and cellular needs.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Predict the amino acid sequences of peptides formed by ribosomes in response to the following mRNA sequences, assuming that the reading frame begins with the first three bases in each sequence. (a) GGUCAGUCGCUCCUGAUU (b) UUGGAUGCGCCAUAAUUUGCU (c) CAUGAUGCCUGUUGCUAC (d) AUGGACGAA

The secreted bacterial protein OmpA has a pre-cursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If purified ProOmpA is denatured with 8 m urea and the urea is then removed (such as by running the protein solution rapidly through a gel filtration column), the protein can be translocated across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if ProOmpA is first allowed to incubate for a few hours in the absence of urea. Furthermore, the capacity for translocation is maintained for an extended period if ProOmpA is first incubated in the presence of another bacterial protein called trigger factor. Describe the probable function of this factor.

Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. (a) What features of \(t R N A^{\text {Ala }}\) are recognized by Ala-tRNA synthetase? (b) Describe the consequences of a \(\mathrm{C} \rightarrow \mathrm{G}\) mutation in the third position of the anticodon of tRNA \(^{M_{2}}\) (c) What other kinds of mutations might have similar effects? (d) Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.)

The template strand of a segment of double-helical DNA contains the sequence \(\left(5^{\prime}\right)\) CTTAACACCCCTGACTTCGCGCCGTCG(3') (a) What is the base sequence of the mRNA that can be transcribed from this strand? (b) What amino acid sequence could be coded by the mRNA in (a), starting from the \(5^{\prime}\) end? (c) If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.