Chapter 27: Problem 1
Predict the amino acid sequences of peptides formed by ribosomes in response to the following mRNA sequences, assuming that the reading frame begins with the first three bases in each sequence. (a) GGUCAGUCGCUCCUGAUU (b) UUGGAUGCGCCAUAAUUUGCU (c) CAUGAUGCCUGUUGCUAC (d) AUGGACGAA
Short Answer
Expert verified
(a) Gly-Gln-Ser-Leu-Leu-Ile
(b) Leu-Asp-Ala-Pro
(c) His-Asp-Ala-Cys-Cys-Tyr
(d) Met-Asp-Glu
Step by step solution
01
Understanding Codons and Translation
In molecular biology, translation is the process by which ribosomes convert mRNA sequences into amino acid chains, forming proteins. Each group of three bases (nucleotides) in mRNA is called a codon, and each codon corresponds to a specific amino acid or a stop signal during protein synthesis.
02
Using Genetic Code Chart
To predict the amino acids, we will use the genetic code chart which maps mRNA codons to amino acids. For example, AUG codes for Methionine, UAA, UAG, and UGA are stop codons that signal the end of translation.
03
Decoding Sequence (a) GGUCAGUCGCUCCUGAUU
Divide the sequence into codons: GGU-CAG-UCG-CUC-CUG-AUU. Using the genetic code chart, translate each codon: GGU - Glycine (Gly), CAG - Glutamine (Gln), UCG - Serine (Ser), CUC - Leucine (Leu), CUG - Leucine (Leu), AUU - Isoleucine (Ile). Thus, the peptide sequence is Gly-Gln-Ser-Leu-Leu-Ile.
04
Decoding Sequence (b) UUGGAUGCGCCAUAAUUUGCU
Divide the sequence into codons: UUG-GAU-GCG-CCA-UAA-UUU-GCU. Translate each codon: UUG - Leucine (Leu), GAU - Aspartic acid (Asp), GCG - Alanine (Ala), CCA - Proline (Pro), UAA - Stop, UUU - Phenylalanine (Phe), GCU - Alanine (Ala). Translation stops at the stop codon (UAA), so the peptide sequence is Leu-Asp-Ala-Pro.
05
Decoding Sequence (c) CAUGAUGCCUGUUGCUAC
Divide the sequence into codons: CAU-GAU-GCC-UGU-UGC-UAC. Translate each codon: CAU - Histidine (His), GAU - Aspartic acid (Asp), GCC - Alanine (Ala), UGU - Cysteine (Cys), UGC - Cysteine (Cys), UAC - Tyrosine (Tyr). Thus, the peptide sequence is His-Asp-Ala-Cys-Cys-Tyr.
06
Decoding Sequence (d) AUGGACGAA
Divide the sequence into codons: AUG-GAC-GAA. Translate each codon: AUG - Methionine (Met), GAC - Aspartic acid (Asp), GAA - Glutamic acid (Glu). Thus, the peptide sequence is Met-Asp-Glu.
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
Translation Process
Translation is a fundamental biological process that turns genetic information into functional proteins. It happens inside the cell, where ribosomes play a key role.
Ribosomes read messenger RNA (mRNA) sequences and translate them into amino acids, which are the building blocks of proteins. This process is crucial for maintaining the functions of every living cell. Here's how it works:
Ribosomes read messenger RNA (mRNA) sequences and translate them into amino acids, which are the building blocks of proteins. This process is crucial for maintaining the functions of every living cell. Here's how it works:
- The mRNA sequence, which is a copy of a gene's DNA, travels from the nucleus to the cytoplasm where translation occurs.
- Ribosomes latch onto the mRNA and start reading it three bases at a time. These three-base chunks are known as codons.
- Each codon specifies a particular amino acid, which is brought to the ribosome by transfer RNA (tRNA). The tRNA molecules match codons with their corresponding amino acids.
- The ribosome assembles amino acids into a growing polypeptide chain until it reaches a stop codon, signaling the end of the protein synthesis.
mRNA Sequences
Messenger RNA (mRNA) sequences are composed of nucleotides that serve as a template for protein synthesis.
Unlike DNA, which contains thymine (T), mRNA contains uracil (U) replacing it. This change is important because it helps mRNA interact with other cell machinery during translation. mRNA is transcribed from DNA and carries the genetic information from the nucleus to the cytoplasm.
There, it provides the instructions needed by ribosomes to build proteins. Some key points about mRNA sequences:
Unlike DNA, which contains thymine (T), mRNA contains uracil (U) replacing it. This change is important because it helps mRNA interact with other cell machinery during translation. mRNA is transcribed from DNA and carries the genetic information from the nucleus to the cytoplasm.
There, it provides the instructions needed by ribosomes to build proteins. Some key points about mRNA sequences:
- They are read in the 5' to 3' direction by ribosomes, ensuring the correct reading frame is maintained.
- A reading frame is established by the start codon (AUG), which signals the beginning of translation.
- The sequence is divided into continuous and non-overlapping codons, ordered successively to ensure precise protein building.
Codon-Amino Acid Mapping
Codon-amino acid mapping is a universal genetic code that allows the translation of nucleotide sequences into amino acids.
Each of the 64 codons in mRNA corresponds to one of the 20 amino acids or a stop signal. Here's how the mapping works:
Each of the 64 codons in mRNA corresponds to one of the 20 amino acids or a stop signal. Here's how the mapping works:
- Each codon is made up of three nucleotides, forming combinations of the four bases: adenine (A), cytosine (C), guanine (G), and uracil (U).
- This combination results in multiple codons for the same amino acid, a phenomenon known as redundancy. For instance, GGU, GGC, GGA, and GGG all code for glycine.
- Some codons like UAA, UAG, and UGA serve as stop signals to end protein synthesis.
- The codon AUG is particularly important as it codes for methionine, the amino acid that typically initiates protein synthesis.