/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 Preserving DNA in Bacterial Endo... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Preserving DNA in Bacterial Endospores Bacterial endospores form when the environment is no longer conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. \(B\). subtilis spores are much more resistant than are the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations. (a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations? (b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

Short Answer

Expert verified
Decreased water content reduces hydrolytic damage. SASPs protect against UV-induced cyclobutane dimer formation, preventing DNA mutations.

Step by step solution

01

Understanding the Effect of Decreased Water Content

Water in cells plays a key role in biochemical reactions, including those that can lead to mutations. In dry environments, hydrolysis reactions, which can damage DNA, are minimized. In bacterial endospores, the reduced water content prevents these hydrolysis reactions, thereby decreasing the risk of water-mediated DNA damage, such as the spontaneous deamination of cytosine to uracil.
02

Explaining Cyclobutane Dimer Formation

Cyclobutane pyrimidine dimers (CPDs) are a kind of damage induced in DNA by ultraviolet (UV) radiation. They occur when UV light causes adjacent pyrimidine bases (such as thymine or cytosine) on a DNA strand to bond together, distorting the DNA structure and promoting mutations.
03

Role of Small Acid-Soluble Proteins (SASPs)

SASPs bind tightly to DNA in bacterial spores, changing DNA's structure and thereby shielding it from UV light. By preventing the formation of CPDs, SASPs help avoid mutations that can arise from exposure to UV radiation, ensuring the genetic material remains stable during long periods of dormancy.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Bacillus subtilis
Bacillus subtilis is a remarkable bacterium capable of forming endospores. These spores are survival capsules allowing the organism to withstand extreme conditions. When nutrients become scarce, Bacillus subtilis initiates a process called sporulation. This results in a small, tough structure that can remain inert for extensive periods, sometimes over 1,000 years.

This dormancy feature is crucial, making Bacillus subtilis spores highly resistant to environmental hazards like heat, ultraviolet (UV) radiation, and chemical damage. These spores protect the bacterial DNA from damage, preserving its integrity and ensuring the bacterium's survival until favorable conditions return.

Bacillus subtilis not only serves as a model organism for studying bacterial spore formation but also provides insights into how life can adapt to extreme conditions. This adaptability makes it a significant focus in research, particularly in understanding DNA preservation mechanisms.
Small Acid-Soluble Proteins (SASPs)
Small Acid-Soluble Proteins, or SASPs, play a pivotal role in protecting DNA inside bacterial spores. These proteins are unique to spore-forming bacteria like Bacillus subtilis. SASPs bind to spore DNA and reshape its structure, thereby safeguarding it from various forms of physical and chemical stress.

One crucial function is their ability to shield DNA from ultraviolet (UV) radiation. UV light can cause severe DNA damage by inducing structural changes, which SASPs prevent.

The presence of SASPs ensures that when conditions improve, and the spore returns to a vegetative state, the DNA remains unaltered and the bacterium can resume normal functions without mutations.
Cyclobutane Pyrimidine Dimers
Cyclobutane pyrimidine dimers (CPDs) arise when UV radiation affects DNA. UV exposure causes neighboring pyrimidine bases, like cytosine and thymine, to form abnormal bonds.

This bond leads to structural kinks in the DNA, distorting its normal shape, interrupting cellular processes like replication and transcription, and potentially causing harmful mutations.

Preventing the formation of CPDs is crucial for the survival of bacterial endospores. Mechanisms such as the action of SASPs in bacteria like Bacillus subtilis are employed to safeguard DNA integrity during dormancy.

This natural protection system ensures that when the time comes for the spore to transition back into an active cell, the DNA is intact and mutation-free, allowing for normal cellular activities to resume.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Sanger Sequencing Logic In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide triphosphate- say, ddCTP- is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What result. would be observed if the dCTP were omitted?

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for \(\mathrm{T}\) ) is constructed, will its melting temperature be higher or lower?

The Structure of DNA Elucidation of the three-dimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.pdb.org). Use the PDB identifiers listed below to retrieve the structure surnuraries for the two forms of DNA. Open the structures using Jmol, and use the controls in the Jmol menu (accessed with a control-click or by clicking on the Jmol logo in the lower right corner of the image screen) to complete the following exercises. Refer to the Jmol help links as needed. (a) Obtain the file for \(141 \mathrm{D}\), a highly conserved, repeated DNA sequence from the end of the HIV-1 (the virus that causes AIDS) genome. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Identify the \(5^{\prime}\) end of each strand. Locate the major and minor grooves. Is this a right- or left-handed helix? (b) Obtain the file for \(145 \mathrm{D}\), a DNA with the \(\mathrm{Z}\) conformation. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix? (c) To fully appreciate the secondary structure of DNA, view the molecules in stereo. On the control menu, Select \(>\) All, then Style \(>\) Stereographic \(>\) Cross-eyed viewing or Wall-eyed viewing. (If you have stereographic glasses available, select the appropriate option.) You will see two images of the DNA molecule. Sit with your nose approximately 10 inches from the monitor and focus on the tip of your nose (cross-eyed) or the opposite edges of the screen (wall-eyed). In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three-dimensional. (Note that only one of the two authors can make this work.)

DNA of the Human Body Calculate the weight in grams of a double-helical DNA molecule stretching from the Earth to the moon \((\sim 320,000 \mathrm{km}) .\) The DNA double helix weighs about \(1 \times 10^{-18}\) gper 1,000 nucleotide pairs; each base pair extends 3.4 A. For an interesting comparison, your body contains about 0.5 g of DNA!

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.