/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 6 Nucleotide Chemistry The cells o... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G}=\mathrm{C}(\text { not } \mathrm{A}=\mathrm{T})\) base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

Short Answer

Expert verified
Cells have a specialized G-T repair system because G-T mismatches are more stable and could bypass general repair, leading to mutations.

Step by step solution

01

Understanding DNA Structure

DNA consists of base pairs, typically adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). These base pairs are held together by hydrogen bonds and maintain the double helix structure of DNA. A mismatch occurs when these pairs are not matched correctly, such as when G pairs with T instead of C.
02

Identifying the Problem in G-T Mismatch

A G-T mismatch introduces instability in the DNA molecule because G and T do not form the usual strong hydrogen bonds. This instability can lead to mutations during DNA replication, as the incorrect pairing could be propagated if not corrected.
03

General Mismatch Repair System

Cells have a general mismatch repair system that identifies and corrects mistakes during DNA replication. This system predominantly repairs mismatched bases through proofreading mechanisms, reducing the mutation rate by recognizing mismatches and correcting them to the standard A-T and G-C pairings.
04

Need for Specialized G-T Repair System

Despite the general repair system, G-T mismatches specifically require a specialized repair mechanism. This is because G-T pairing is relatively more stable than other mismatch combinations, potentially evading detection or being incorrectly repaired to A-T. Hence, a specialized system ensures these mismatches are reliably corrected to G-C, maintaining genomic stability.
05

Conclusion on Specialized Repair Requirement

The specialized repair system for G-T mismatches ensures high fidelity in genetic information by preventing mutations that could arise from the more permissively detected G-T pairing. This system adds an extra layer of accuracy beyond what the general repair system can achieve, crucially for maintaining genetic integrity.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

G-T Mismatch
In the world of DNA, the rule is that certain bases should always pair with specific partners: guanine (G) with cytosine (C) and adenine (A) with thymine (T). However, sometimes nature makes little mistakes—one such error is the G-T mismatch. This occurs when guanine pairs with thymine instead of its regular partner, cytosine. These mismatches can cause problems because G and T do not form the right hydrogen bonds to maintain the DNA's stable structure.

Without correction, this tiny blip can lead to big issues, like a kink in the DNA. That's why cells have developed specialized systems specifically to hunt down and fix G-T mismatches. They ensure that the DNA chain is strong and unwavering in its proper form. This mechanism carefully corrects G-T pairs back to G-C pairs, eliminating the instability that could lead to potentially harmful mutations.
Genomic Stability
Genomic stability is like the blueprint's master plan. It's crucial for an organism’s survival and health, ensuring that each time DNA is replicated, it remains faithful to the original template.

Why is this important? Because any deviation—like a mismatched base pair—can escalate into a significant error. G-T mismatches may not seem much on the surface, but they undermine genomic stability by potentially introducing errors during cell division. These mistakes, if not corrected, can evolve into mutations that hinder cellular functions or even cause diseases.

Therefore, the presence of a specialized G-T repair mechanism reinforces the general repair system, acting as a safeguard. It ensures no mismatches slip through unnoticed, further cementing the integrity and continuity of the genetic material. By patching up these errors, cells maintain robust genomic stability, which is vital for healthy growth and function.
Mutation Prevention
Picture a cell like a diligent editor, proofreading each line of a manuscript to eliminate errors. Mutation prevention in cells works similarly to avoid mistakes that could alter the genetic message. Mutations are permanent alterations that can be benign or, unfortunately, devastating if they disrupt important genetic instructions.

The risk of mutation becomes real when mismatches, such as the G-T variety, are overlooked during DNA replication. Without intervention, these mismatches can lead to erroneous genetic information being passed on to the next generation of cells.

This is why precise and efficient repair systems are in place, acting like a double-checking system. The specialized G-T repair mechanism prioritizes fixing any slip-ups that occur, thus preventing dangerous mutations from occurring. By doing so, it plays a key role in mutation prevention, safeguarding organisms from deleterious changes and ensuring accurate DNA replication.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Solubility of the Components of DNA Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimen- sional structure of double-stranded DNA?

Nucleic Acid Structure Explain why the absorption of UV light by double- stranded DNA increases (the hyperchromic effect \()\) when the DNA is denatured.

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double- stranded DNA have the potential to form any alternative structures?

Preserving DNA in Bacterial Endospores Bacterial endospores form when the environment is no longer conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. \(B\). subtilis spores are much more resistant than are the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations. (a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations? (b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.