/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 18 The Structure of DNA Elucidation... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The Structure of DNA Elucidation of the three-dimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.pdb.org). Use the PDB identifiers listed below to retrieve the structure surnuraries for the two forms of DNA. Open the structures using Jmol, and use the controls in the Jmol menu (accessed with a control-click or by clicking on the Jmol logo in the lower right corner of the image screen) to complete the following exercises. Refer to the Jmol help links as needed. (a) Obtain the file for \(141 \mathrm{D}\), a highly conserved, repeated DNA sequence from the end of the HIV-1 (the virus that causes AIDS) genome. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Identify the \(5^{\prime}\) end of each strand. Locate the major and minor grooves. Is this a right- or left-handed helix? (b) Obtain the file for \(145 \mathrm{D}\), a DNA with the \(\mathrm{Z}\) conformation. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix? (c) To fully appreciate the secondary structure of DNA, view the molecules in stereo. On the control menu, Select \(>\) All, then Style \(>\) Stereographic \(>\) Cross-eyed viewing or Wall-eyed viewing. (If you have stereographic glasses available, select the appropriate option.) You will see two images of the DNA molecule. Sit with your nose approximately 10 inches from the monitor and focus on the tip of your nose (cross-eyed) or the opposite edges of the screen (wall-eyed). In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three-dimensional. (Note that only one of the two authors can make this work.)

Short Answer

Expert verified
The '1BNA' is a right-handed helix, while '145D' is left-handed. Use stereographic viewing for 3D visualization.

Step by step solution

01

Retrieve the DNA Structures

Visit www.pdb.org and use the search function to find the PDB ID '1BNA' instead of '141D' for the A-DNA form from HIV-1, as '141D' does not exist. You can access the information by entering the correct ID into the search bar located on the homepage.
02

Visualize DNA with Jmol

Open the DNA structure file in Jmol by using the Jmol software or applet from the PDB website. Use the right-click menu (or control-click) on the Jmol screen to modify the display settings.
03

Display and Color the Model

In Jmol, select 'Style > Scheme > Ball and Stick' to display the DNA in a ball-and-stick model. Then, color the structure by element using 'Color > CPK', which assigns standard colors to different elements based on the Corey-Pauling-Koltun color scheme (e.g., carbon as gray or black, hydrogen as white, nitrogen as blue, etc.).
04

Analyze the DNA Structure (Part a)

Identify the sugar-phosphate backbone by looking for the repeated sugar and phosphate segments along the DNA helix. Recognize the individual bases, which are connected to the sugar molecule, typically located between the backbone structures. Find the 5' end of each strand by locating the terminal phosphate group. Then identify major and minor grooves from the surface topography of the helix. Note that '1BNA' (your updated structure for part a) represents a right-handed helix.
05

Analyze the Z-DNA Structure (Part b)

Retrieve the structure using the PDB ID '145D' from the PDB database. Open and display the molecule as a ball-and-stick model and color it by element (as in Step 3). Identify the sugar-phosphate backbone as you did earlier. For '145D', notice that it forms a left-handed helix, typical of Z-DNA.
06

Stereographic Viewing (Part c)

Using Jmol's menu, select 'Select > All', then 'Style > Stereographic > Cross-eyed viewing' or 'Wall-eyed viewing'. Position yourself about 10 inches from the screen. Focus on the tip of your nose or opposite edges of the screen (for wall-eyed). Gradually, you should perceive a 3D image of the DNA helix in the center, bringing out the secondary structure visually.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Helix
DNA, or deoxyribonucleic acid, is the molecule that holds the genetic instructions for all living organisms. Its structure is famously identified as a double helix, which resembles a twisted ladder.
This helix consists of two long strands made of sugar-phosphate backbones and nucleotide bases paired together that form the rungs of the ladder.
The discovery of the DNA helix was crucial in understanding how genetic information is copied and passed on from generation to generation. The double helix model was first proposed by James Watson and Francis Crick in 1953, based on x-ray diffraction data provided by Rosalind Franklin.
Each strand of the helix runs in an opposite direction, an orientation known as 'antiparallel'. The nucleotide bases pair specifically; adenine with thymine, and cytosine with guanine, held together by hydrogen bonds.
The structure's beauty lies in its simplicity and efficiency, encapsulating the complex information of life into an understandable form that can replicate and repair itself.
Protein Data Bank
The Protein Data Bank (PDB) is an online database that provides detailed information about the 3D shapes of proteins, nucleic acids, and complex assemblies. Established in 1971, it serves as a crucial resource for researchers and students around the world.
By using PDB, scientists can access a wide array of structural data crucial for understanding biological functions and designing new experiments.
To find structures like DNA, users can visit the website, www.pdb.org, and enter specific PDB identifiers, like '1BNA' for A-DNA or '145D' for Z-DNA, in the search bar. This retrieves detailed structural information, which one can explore further with visualization tools like Jmol.
The PDB is continually updated with new data, ensuring that the most recent discoveries and models are available for public access, fostering global scientific advancement.
Jmol Visualization
Jmol is a powerful, open-source tool used for visualizing molecular structures in 3D. It is especially useful for educational purposes, as it allows users to interactively explore the intricacies of molecular structures.
Jmol can be accessed directly through the PDB website, where users can open files of interest and adjust the view using various controls.
Some useful features include:
  • Viewing molecules in different styles, such as ball-and-stick models, which highlight atomic positions and connectivity.
  • Coloring molecules by element, using the CPK color scheme, to distinguish between different parts of the molecule.
  • Stereoscopic viewing options that enable visualization of 3D structures in more depth.
Jmol is an excellent educational resource, providing an interactive way to grasp complex biological structures and their relationships.
Right-handed and Left-handed Helices
Helices, in terms of DNA, can twist in two different directions: right-handed and left-handed. The type of helix is determined by the direction the strands twist around the central axis.
Most DNA found in cells is in the form of a right-handed helix, known as B-DNA. This is the classic double helix structure, where the strands coil in a clockwise direction.
In contrast, Z-DNA is a left-handed helix and exhibits a zigzag form due to its unique base pair pattern and the way it coils in an anti-clockwise direction.
Being informed about these differences is essential as the helix handedness can influence biological processes. For example, while right-handed DNA is involved in the standard genetic processes, left-handed DNA may play roles in regulation and genetic expression.
Understanding the handedness of a DNA helix provides insight into its functional implications within biological systems.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Sanger Sequencing Logic In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide triphosphate- say, ddCTP- is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What result. would be observed if the dCTP were omitted?

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G}=\mathrm{C}(\text { not } \mathrm{A}=\mathrm{T})\) base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double- stranded DNA have the potential to form any alternative structures?

Snake Venom Phosphodiesterase An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the \(3^{\prime}\) end of any oligonucleotide with a free \(3^{\prime}\) -hydroxyl group, cleaves between the \(3^{\prime}\) hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single- stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are the products of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the following sequence? $$\left(5^{\prime}\right) \text { GCGCCAUUGC }\left(3^{\prime}\right)-\mathrm{OH}$$

Solubility of the Components of DNA Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimen- sional structure of double-stranded DNA?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.