/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 Snake Venom Phosphodiesterase An... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Snake Venom Phosphodiesterase An exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the \(3^{\prime}\) end of any oligonucleotide with a free \(3^{\prime}\) -hydroxyl group, cleaves between the \(3^{\prime}\) hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single- stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are the products of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the following sequence? $$\left(5^{\prime}\right) \text { GCGCCAUUGC }\left(3^{\prime}\right)-\mathrm{OH}$$

Short Answer

Expert verified
Partial digestion yields different nucleotide monophosphates and smaller sequences.

Step by step solution

01

Understand the Enzyme Function

Snake venom phosphodiesterase is an exonuclease that cleaves nucleotides sequentially from the free 3'-end of an oligonucleotide. It breaks the bond between the 3'-hydroxyl group of the sugar and the phosphate group of the adjacent nucleotide without base specificity.
02

Analyze the Function on the Given Sequence

Given the oligonucleotide sequence is: \( (5') \text{GCGCCAUUGC}(3')-\text{OH} \). The enzyme will start cleaving from the 3'-end, which in this sequence is the 'C' with the free 3'-hydroxyl group.
03

Determine Initial Cleavage Product

In the first reaction, the enzyme cleaves the 3'-end nucleotide 'C', resulting in a monophosphate nucleotide release and leaving the sequence: \( (5') \text{GCGCCAUG}\left(3'\right)-\text{OH} \). The released product is a cytidine 3'-monophosphate (CMP).
04

Continuing Partial Digestion

During partial digestion, the enzyme continues to sequentially cleave nucleotides. After partial digestion, possible products might include shorter sequences and monophosphate nucleotide fragments such as uridine 3'-monophosphate (UMP), adenine 3'-monophosphate (AMP), and guanine 3'-monophosphate (GMP), given it progresses through the entire sequence.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Exonuclease
Exonucleases are powerful enzymes that specialize in removing nucleotides from the ends of a DNA or RNA strand. These enzymes act much like molecular scissors, snipping away one nucleotide at a time. There are two main types of exonucleases:
  • 5'-end exonucleases: These remove nucleotides starting from the 5'-end of a polynucleotide chain.
  • 3'-end exonucleases: These remove nucleotides starting from the 3'-end, just like snake venom phosphodiesterase does.
Snake venom phosphodiesterase, a 3'-end exonuclease, is particularly adept at breaking the bonds between the phosphates and sugars of nucleotides at the 3'-end of an oligonucleotide. This action makes it incredibly useful for studying nucleic acid sequences, especially before the advent of modern sequencing technologies. With no preference for specific bases, it acts on single-stranded DNA or RNA effectively. Its action leads to a stepwise degradation, helping in the determination of sequences by analyzing the released fragments.
Oligonucleotide 3'-end
The 3'-end of an oligonucleotide is crucial to its structure and function. In nucleotide sequences, each chain has two distinct ends:
  • 5'-end: The beginning of the chain, often marked with a phosphate group.
  • 3'-end: The termination point of the chain, ending with a free hydroxyl group (OH).
The 3'-hydroxyl group is essential because it is the site where exonucleases start their enzymatic activity. In the case of snake venom phosphodiesterase, it specifically targets this region to initiate the sequential removal of nucleotides. Understanding the role of the 3'-end in enzymatic activities is key to grasping nucleotide sequence analysis, as it helps pinpoint where the nucleotide chain begins to unravel through enzyme action.
Nucleotide Sequence Determination
Nucleotide sequence determination involves figuring out the order of nucleotides in a DNA or RNA molecule. Before advanced techniques like automated sequencing came on the scene, enzymes like snake venom phosphodiesterase were essential tools. They worked by progressively digesting nucleotide chains, allowing researchers to identify released nucleotides and determine sequence information from long chains. The sequence determination process with an exonuclease involves:
  • Starting at the 3'-end: The enzyme breaks down the chain sequentially, moving toward the 5'-end.
  • Identifying released nucleotides: Each nucleotide is sequentially detached and can be isolated and identified, helping deduce the order on the original strand.
This approach can result in partial digestion products, which are then analyzed to infer the sequence. Although modern methods have surpassed this technique in speed and accuracy, understanding this enzymatic approach provides foundational knowledge in molecular biology and genetics.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for \(\mathrm{T}\) ) is constructed, will its melting temperature be higher or lower?

DNA of the Human Body Calculate the weight in grams of a double-helical DNA molecule stretching from the Earth to the moon \((\sim 320,000 \mathrm{km}) .\) The DNA double helix weighs about \(1 \times 10^{-18}\) gper 1,000 nucleotide pairs; each base pair extends 3.4 A. For an interesting comparison, your body contains about 0.5 g of DNA!

Solubility of the Components of DNA Draw the following structures and rate their relative solubilities in water (most soluble to least soluble): deoxyribose, guanine, phosphate. How are these solubilities consistent with the three-dimen- sional structure of double-stranded DNA?

The Structure of DNA Elucidation of the three-dimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.pdb.org). Use the PDB identifiers listed below to retrieve the structure surnuraries for the two forms of DNA. Open the structures using Jmol, and use the controls in the Jmol menu (accessed with a control-click or by clicking on the Jmol logo in the lower right corner of the image screen) to complete the following exercises. Refer to the Jmol help links as needed. (a) Obtain the file for \(141 \mathrm{D}\), a highly conserved, repeated DNA sequence from the end of the HIV-1 (the virus that causes AIDS) genome. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Locate and identify individual bases. Identify the \(5^{\prime}\) end of each strand. Locate the major and minor grooves. Is this a right- or left-handed helix? (b) Obtain the file for \(145 \mathrm{D}\), a DNA with the \(\mathrm{Z}\) conformation. Display the molecule as a ball-and-stick structure and color by element. Identify the sugar-phosphate backbone for each strand of the DNA duplex. Is this a right- or left-handed helix? (c) To fully appreciate the secondary structure of DNA, view the molecules in stereo. On the control menu, Select \(>\) All, then Style \(>\) Stereographic \(>\) Cross-eyed viewing or Wall-eyed viewing. (If you have stereographic glasses available, select the appropriate option.) You will see two images of the DNA molecule. Sit with your nose approximately 10 inches from the monitor and focus on the tip of your nose (cross-eyed) or the opposite edges of the screen (wall-eyed). In the background you should see three images of the DNA helix. Shift your focus to the middle image, which should appear three-dimensional. (Note that only one of the two authors can make this work.)

DNA Bending Assume that a poly(A) tract five base pairs long produces a \(20^{\circ}\) bend in a DNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA) \(_{5}\) tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helix.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.