/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 10 Nucleic Acid Structure Explain w... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Nucleic Acid Structure Explain why the absorption of UV light by double- stranded DNA increases (the hyperchromic effect \()\) when the DNA is denatured.

Short Answer

Expert verified
Denatured DNA has separated strands, exposing more bases and increasing UV absorbance.

Step by step solution

01

Understanding DNA Denaturation

DNA denaturation involves the separation of double-stranded DNA into single strands. This process can be induced by heating or chemical treatment, leading to the disruption of hydrogen bonds between the base pairs that hold the strands together.
02

UV Light and Nucleic Acids

Nucleic acids absorb UV light due to the aromatic rings in the nucleotide bases. The absorption peaks around 260 nm, with free nucleotide bases absorbing more UV light than when they are paired in the double-helix structure.
03

The Hyperchromic Effect in DNA

The hyperchromic effect describes the increased absorption of UV light when DNA is denatured. In double-stranded DNA, the bases are stacked and hydrogen-bonded, restricting their exposure to UV light. When denatured, the strands separate, exposing more of the bases to UV light, which increases absorbance.
04

Molecular Dynamics and Base Stacking

In the double-helix structure, base stacking contributes to reduced UV absorbance. Stacked bases interact through dipole-dipole interactions, and their transition dipoles combine, lessening light absorption. Upon denaturation, these interactions are disrupted, increasing UV absorption.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Hyperchromic Effect
When DNA is in its double-helix form, it absorbs ultraviolet (UV) light at a specific wavelength, typically around 260 nm. You might notice something interesting when DNA becomes denatured. The absorption of UV light increases in this state. This phenomenon is known as the hyperchromic effect.

The hyperchromic effect occurs because, during denaturation, the tightly coiled double strands of DNA unravel into single strands. As a result, the bases, which were once paired and slightly hidden, become more exposed.

This increased exposure to UV light results in higher absorption. Essentially, more UV light gets absorbed because more of the DNA's bases are available to interact with the light. It's like opening a book fully instead of just peeking between the pages.
Nucleic Acid Structure
Nucleic acids, like DNA, have a fascinating structure that is crucial for their function. DNA is composed of long chains of nucleotides, which form the backbone of the molecule. Each nucleotide consists of three parts: a sugar molecule, a phosphate group, and a nitrogenous base.

In double-stranded DNA, two strands are twisted around each other, forming a classic double-helix shape. This structure is stabilized by hydrogen bonds forming between complementary bases: adenine pairs with thymine, and cytosine pairs with guanine.

Base stacking, which is the interaction between bases on the same strand, also helps maintain the double-helix structure. These stacked bases are aligned in such a way to minimize their distance, creating interactions that contribute to the stability of the DNA. These interactions also affect how DNA absorbs UV light, as they shield the bases.
UV Light Absorption in DNA
DNA has a specific way of interacting with UV light, thanks to its structure. The aromatic rings present in the bases of DNA allow it to absorb UV light. Specifically, DNA absorbs strongly at 260 nm due to these aromatic structures.

When DNA is double-stranded, the base pairs are stacked tight, limiting their ability to absorb much UV light because they are less exposed. However, when DNA becomes single-stranded during denaturation, the bases are exposed more to UV light.

This change in exposure leads to increased absorption. As a result, we can say that the capability of DNA to absorb UV light effectively acts as an indicator of DNA's structural state—whether it is double-stranded or the strands have unwound into single strands.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCGCAATATTTCTCAAAATATTGCGC(3'). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the double- stranded DNA have the potential to form any alternative structures?

Preserving DNA in Bacterial Endospores Bacterial endospores form when the environment is no longer conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. \(B\). subtilis spores are much more resistant than are the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations. (a) One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations? (b) Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

DNA Bending Assume that a poly(A) tract five base pairs long produces a \(20^{\circ}\) bend in a DNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA) \(_{5}\) tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helix.

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for \(\mathrm{T}\) ) is constructed, will its melting temperature be higher or lower?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.