/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Essential Biochemistry Chapter 3 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 23

Explain whether the following statement is true or false: Because a G:C base pair is stabilized by three hydrogen bonds, whereas an A:T base pair is stabilized by only two hydrogen bonds, GC-rich DNA is harder to melt than AT- rich DNA.

Problem 24

Hydrogen bonding does not make a significantly large contribution to the overall stability of the DNA molecule. Explain.

Problem 26

a. Would you expect proteins to bind to the major groove or the minor groove of DNA? Explain. b. Eukaryotic DNA is packaged with histones, small proteins with a high lysine and arginine content. Why do histones have a high affinity for DNA?

Problem 29

What might you find in comparing the GC content of DNA from Thermus aquaticus or Pyrococcus furiosus and DNA from bacteria in a typical backyard pond?

Problem 30

Explain why the melting temperature of a sample of doublehelical DNA increases when the \(\mathrm{Na}^{+}\)concentration increases.

Problem 31

a. You have a short piece of synthetic RNA that you want to use as a probe to identify a gene in a sample of DNA. The RNA probe has a tendency to hybridize with sequences that are only weakly complementary. Should you increase or decrease the temperature to improve your chances of tagging the correct sequence? b. You have a short piece of single-stranded DNA that you want to hybridize to another strand of DNA with one mismatched base pair between the two strands. Should you increase or decrease the temperature to improve your chances of annealing the two strands?

Problem 32

In the laboratory technique known as fluorescence in situ hybridization (FISH), a fluorescent oligonucleotide probe is allowed to hybridize with a cell's chromosomes, which are typically spread on a microscope slide. Explain why the chromosome preparation must be heated before the probe is added to it.

Problem 33

Discuss the shortcomings of the following definitions for gene: a. A gene is the information that determines an inherited characteristic such as flower color. b. A gene is a segment of DNA that encodes a protein. c. A gene is a segment of DNA that is transcribed in all cells.

Problem 35

A segment of the coding strand of a gene is shown below. ACACCATGGTGCATCTGACT a. Write the sequence of the complementary strand that DNA polymerase would make. b. Write the sequence of the mRNA that RNA polymerase would make from the gene segment.

Problem 36

A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCT- 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGA- GCTGACGCTGCTCGTCG-3 CGACTGCGACGAGCAGC-5 The sequence of the mRNA transcribed from this gene has the following sequence: 5 -AUGAUUCGCCUCGGGGCUCCCCAGUCGCUG- GUGCUGCUGACGCUGCUCGUCG-3 a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks