/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 30 Explain why the melting temperat... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Explain why the melting temperature of a sample of doublehelical DNA increases when the \(\mathrm{Na}^{+}\)concentration increases.

Short Answer

Expert verified
Increased \(\mathrm{Na}^{+}\) concentration stabilizes DNA by neutralizing charges, raising melting temperature.

Step by step solution

01

Understand the Role of \\ \(\mathrm{Na}^{+}\) in Stabilizing DNA

The DNA double helix is made up of two strands of nucleotides held together by hydrogen bonds and ionic interactions. These interactions are influenced by the presence of ions in the solution. The \(\mathrm{Na}^{+}\) ions interact with the negatively charged phosphate backbone of DNA, shielding the repulsive forces between the strands.
02

Assess the Effect of Higher \\ \(\mathrm{Na}^{+}\) Concentration

When the concentration of \(\mathrm{Na}^{+}\) increases, more ions are available to neutralize the negative charges on the DNA backbone. This reduction in repulsive forces allows the strands to hold together more tightly.
03

Link Stabilization to Melting Temperature

The melting temperature of DNA is the temperature at which the DNA strands separate, indicating the breaking of hydrogen bonds and ionic interactions. With increased \(\mathrm{Na}^{+}\) concentration, the additional stabilization leads to a higher melting temperature because more energy (higher temperature) is required to separate the strands.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Melting Temperature
The melting temperature, often abbreviated as Tm, is a crucial concept when studying DNA. It represents the temperature at which 50% of a double-stranded DNA becomes single-stranded. This indicates the breaking of hydrogen bonds and ionic interactions between the DNA strands. Many variables influence the melting temperature, including the DNA sequence and structure. Specific pairs of nucleotide bases, such as cytosine and guanine, contribute more to stability. This is due to their three hydrogen bonds as opposed to the two hydrogen bonds of adenine-thymine pairs. Overall, a higher melting temperature suggests a more stable DNA helix. Higher levels of stability mean that more thermal energy is required to break the connections between bases and separate the strands. Additionally, factors such as pH, solvent properties, and ion concentrations can further influence the melting temperature. For example, increasing sodium ion concentration can enhance stability, thus raising the Tm, as explained below.
Sodium Ion Concentration
Sodium ions (\(\mathrm{Na}^+\)) play a vital role in the stability of DNA. Due to its nature, the DNA phosphate backbone is negatively charged. This negative charge can create repulsive forces along the strands of the DNA molecule. When sodium ions are introduced into the environment surrounding the DNA, they effectively shield these negative charges.
  • Sodium ions interact with the phosphate groups.
  • This interaction neutralizes some repulsion between the strands.
  • As a result, DNA strands can hold together more tightly.
This means that, with a higher sodium concentration, DNA maintains its structure better under stress, because the strands are less likely to repel each other and separate. As for the melting temperature, higher sodium ion concentrations contribute to a higher melting temperature of DNA, since more stabilizing ions require more thermal energy to disrupt.
DNA Phosphate Backbone
The backbone of DNA consists mainly of repeating units of phosphate and sugar molecules. Known for its stability, it serves as the scaffold that supports the entire double-strand structure. The backbone is negatively charged due to the phosphate groups' presence. This negative charge is beneficial for the water-soluble nature of DNA, allowing it to readily dissolve in biological contexts. However, it's also crucial to understand its implications for DNA stability.
  • The negative charges on the phosphate backbone can cause repulsion between the two DNA strands.
  • Such repulsion can destabilize the double helix.
The role of ions, such as sodium ions, is vital in this context since they help neutralize these charges, shielding the backbone and reducing repulsion. Thus, while the phosphate aspect of the backbone influences the electrical characteristics of DNA, it is the interaction with ions that modulates its overall stability.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In 1944 , Avery, MacLeod, and McCarty set out to identify the chemical agent capable of transforming mutant unencapsulated Pneumococcus to the deadly encapsulated form (see Problem 1). They isolated a viscous substance with the chemical and physical properties of DNA that was capable of transformation. If proteases (enzymes that degrade proteins) or ribonucleases (enzymes that degrade RNA) were added prior to the experiment, transformation could still occur. What did these treatments tell the investigators about the molecular identity of the transforming factor?

A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCT- 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGA- GCTGACGCTGCTCGTCG-3 CGACTGCGACGAGCAGC-5 The sequence of the mRNA transcribed from this gene has the following sequence: 5 -AUGAUUCGCCUCGGGGCUCCCCAGUCGCUG- GUGCUGCUGACGCUGCUCGUCG-3 a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

A mutation occurs when there is a base change in the DNA sequence. Some base changes do not lead to changes in the amino acid sequence of the resulting protein. Explain why.

A segment of the coding strand of a gene is shown below. ACACCATGGTGCATCTGACT a. Write the sequence of the complementary strand that DNA polymerase would make. b. Write the sequence of the mRNA that RNA polymerase would make from the gene segment.

Explain whether the following statement is true or false: Because a G:C base pair is stabilized by three hydrogen bonds, whereas an A:T base pair is stabilized by only two hydrogen bonds, GC-rich DNA is harder to melt than AT- rich DNA.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.