/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 In 1944 , Avery, MacLeod, and Mc... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

In 1944 , Avery, MacLeod, and McCarty set out to identify the chemical agent capable of transforming mutant unencapsulated Pneumococcus to the deadly encapsulated form (see Problem 1). They isolated a viscous substance with the chemical and physical properties of DNA that was capable of transformation. If proteases (enzymes that degrade proteins) or ribonucleases (enzymes that degrade RNA) were added prior to the experiment, transformation could still occur. What did these treatments tell the investigators about the molecular identity of the transforming factor?

Short Answer

Expert verified
The treatments showed that proteins and RNA are not the transforming factors; DNA is responsible for transformation.

Step by step solution

01

Understanding the Experiment

In the experiment conducted by Avery, MacLeod, and McCarty, they isolated a substance that could transform non-virulent strains of Pneumococcus into virulent ones. This transformation suggested that the isolated substance carried the genetic information necessary for this change.
02

Applying Enzymes for Verification

The researchers treated the substance with proteases, which degrade proteins, and ribonucleases, which degrade RNA, to determine if proteins or RNA might be the transforming factors. Despite these treatments, the transformation of the bacteria was still observed.
03

Drawing Conclusions About DNA

The transformation occurring despite the degradation of proteins and RNA indicates that neither proteins nor RNA are necessary for this process. This strongly suggests that DNA must be the molecule responsible for the transformation, as it remains intact even after these treatments.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Avery-MacLeod-McCarty Experiment
In 1944, a groundbreaking experiment was conducted by three scientists: Oswald Avery, Colin MacLeod, and Maclyn McCarty. They were determined to identify the mysterious substance responsible for transforming harmless bacteria into a harmful form. This experiment built on the work of Frederick Griffith, who discovered that some kind of "transforming principle" could change the characteristics of bacteria. Avery and his team meticulously isolated this substance from the bacterial samples. Through a series of elaborate procedures, they identified it as DNA, a revelation that revolutionized the field of genetics.

To confirm their findings, Avery, MacLeod, and McCarty treated the substance with enzymes that degrade proteins and RNA. Surprisingly, even after these treatments, the substance still retained its ability to transform bacteria. This observation provided compelling evidence that the observed transformation was not due to proteins or RNA, but rather, it was DNA that harbored the genetic information necessary for transformation.
Pneumococcus Transformation
The story of DNA as the carrier of genetic material began with the study of Pneumococcus bacteria, known for causing pneumonia. This experiment specifically focused on two strains of Pneumococcus: one that was harmless (non-virulent) and another that was lethal (virulent).

When the researchers exposed the harmless strain to the isolated substance, they observed that it transformed into the lethal strain. This transformation indicated that the genetic instructions necessary to make the bacteria virulent were transferred to the non-virulent strain. The transformation process was significant in establishing that the molecule responsible carried not just a simple change, but intricate genetic instructions.
  • This experiment provided the first strong evidence that DNA was the molecule responsible for heredity in living organisms.
  • It showed that the genetic material could carry complex information necessary for an organism's characteristics.
  • The experiment debunked the prevailing thought of the time, which assumed proteins to be the carriers of genetic information due to their diversity and functionality.
Role of DNA in Genetics
The Avery-MacLeod-McCarty experiment was a critical step in identifying DNA as the blueprint for all genetic information. Before this discovery, many scientists believed that proteins, with their complex and varied structures, were responsible for storing and transmitting genetic information. However, their experiment changed the scientific community's understanding completely.

DNA was revealed to be the molecule that contains the instructions needed for the development and functioning of living organisms. It is like a biological encyclopedia full of information necessary for life.
  • DNA's double-helix structure enables it to replicate and encode genetic information.
  • Each strand of DNA consists of a sequence of nucleotides, arranged in a way that holds genetic codes.
  • This becomes the basis for inheritance, as DNA is passed down from parents to offspring.
The role of DNA became central to all genetics research that followed. The discovery laid the groundwork for advances such as the understanding of genetic diseases, DNA fingerprinting, and the human genome project.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCT- 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGA- GCTGACGCTGCTCGTCG-3 CGACTGCGACGAGCAGC-5 The sequence of the mRNA transcribed from this gene has the following sequence: 5 -AUGAUUCGCCUCGGGGCUCCCCAGUCGCUG- GUGCUGCUGACGCUGCUCGUCG-3 a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

A researcher trying to identify the gene for a known protein might begin by looking closely at the protein's sequence in order to design a single-stranded oligonucleotide probe that will hybridize with the DNA of the gene. Why would the researcher focus on a segment of the protein containing a methionine (Met) or tryptophan (Trp) residue (see Table 3.3)?

A diploid organism with a 30,000 -kb haploid genome contains \(19 \%\) T residues. Calculate the number of \(\mathrm{A}, \mathrm{C}, \mathrm{G}\), and \(\mathrm{T}\) residues in the DNA of each cell in this organism.

An open reading frame (ORF) is a portion of the genome that potentially codes for a protein. A given mRNA nucleotide sequence potentially has three different reading frames, only one of which is correct (the selection of the correct ORF will be discussed more fully in Section 22.3). A portion of the gene for a type II human collagen is shown. a. What are the sequences of amino acids that can potentially be translated from each of the three possible reading frames? b. Collagen's amino acid sequence consists of repeating triplets in which every third amino acid is glycine. Does this information assist you in your identification of the correct reading frame? AGGTCTTCAGGGAATGCCTGGCGAGAGGGGAGCAGCTG- GTATCGCTGGGCCCAAAGGC

In a CRISPR-Cas9 gene knock-in experiment, the replacement DNA sequence must differ from the original DNA sequence. Explain.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.