/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 19 Do Chargaft's rules hold true fo... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Do Chargaft's rules hold true for RNA? Explain why or why not.

Short Answer

Expert verified
Chargaff's rules do not apply to RNA because RNA is typically single-stranded.

Step by step solution

01

Understand Chargaff's Rules

Chargaff's rules are applicable to DNA and state that in a double-stranded DNA molecule, the number of adenine (A) bases is approximately equal to the number of thymine (T) bases, and the number of guanine (G) bases is approximately equal to the number of cytosine (C) bases. This is because A pairs with T, and G pairs with C.
02

Identify the Structure of RNA

Unlike DNA, RNA is typically single-stranded. In RNA, adenine (A) pairs with uracil (U) instead of thymine (T), and guanine (G) still pairs with cytosine (C). Because RNA is primarily single-stranded, it does not pair up in the same way as double-stranded DNA does.
03

Analyze Base Pairing in RNA

Since RNA is single-stranded, it doesn't contain equal numbers of complementary bases like A-U or G-C pairs. Thus, on average, there aren't equal numbers of adenine to uracil or guanine to cytosine within a single RNA strand. This differs fundamentally from the base pairing rules seen in double-stranded DNA.
04

Conclusion on Chargaff's Rules and RNA

Chargaff's rules do not apply to RNA due to its typical single-stranded nature. The lack of double-helix structure and pairing means there's no constraint on the ratio of adenine to uracil or guanine to cytosine as seen in DNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Base Pairing
In DNA, base pairing is a crucial concept that ensures the stability and integrity of the genetic material. DNA is composed of two complementary strands that twist around each other to form a double helix. Each strand is made up of a sequence of nucleotides, each containing a sugar, phosphate, and one of four nitrogenous bases: adenine (A), thymine (T), guanine (G), or cytosine (C).
The essence of DNA base pairing emerges from Chargaff's rules, which state that:
  • Adenine (A) always pairs with thymine (T).
  • Guanine (G) always pairs with cytosine (C).
This pairing is due to hydrogen bonds that form between the bases; A and T create two hydrogen bonds, while G and C form three bonds. This makes the DNA structure exceptionally stable. The pairing mechanism ensures that DNA replication is accurate, allowing the genetic code to be passed from one cell generation to the next with high fidelity.
RNA Structure
RNA, or ribonucleic acid, is similar to DNA but with notable differences that influence its structure and function. Unlike DNA, RNA is typically single-stranded, and it contains ribose sugar, whereas DNA has deoxyribose.
RNA also differs in its nitrogenous bases; instead of thymine (T), RNA contains uracil (U). Therefore, in RNA:
  • Adenine (A) pairs with uracil (U).
  • Guanine (G) continues to pair with cytosine (C).
The single-stranded nature of RNA allows it to fold into complex three-dimensional shapes necessary for its roles in biological processes. These structures include loops and helixes crucial for RNA’s functions such as protein synthesis, catalysis, and gene regulation. Despite being single-stranded, certain RNA molecules can undergo intramolecular base pairing where A pairs with U and G pairs with C within the same strand.
Nucleic Acid Biology
Nucleic acids, DNA and RNA, are foundational to the biology of all living organisms. They store and transmit genetic information, guiding protein synthesis and regulating cellular activities.
DNA, with its double-helix structure, provides a stable blueprint for making RNA and proteins. RNA acts as a versatile molecule that transmits information from DNA (through messenger RNA or mRNA) to synthesize proteins, the workhorses of the cell.
Key points in nucleic acid biology include:
  • Replication: DNA replicates itself, ensuring genetic information is conserved.
  • Transcription: DNA's instructions are transcribed into mRNA, which carries the message out of the nucleus.
  • Translation: mRNA is translated into proteins at the ribosome, a process essential for cell function and organismal development.
  • Regulation: RNA molecules also regulate nucleic acid functions by acting as ribozymes or small RNAs that modulate gene expression.
Understanding these processes is vital for appreciating how genetic information flows and is controlled, influencing everything from cell differentiation to complex behaviors in multicellular organisms.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A mutation occurs when there is a base change in the DNA sequence. Some base changes do not lead to changes in the amino acid sequence of the resulting protein. Explain why.

In 1944 , Avery, MacLeod, and McCarty set out to identify the chemical agent capable of transforming mutant unencapsulated Pneumococcus to the deadly encapsulated form (see Problem 1). They isolated a viscous substance with the chemical and physical properties of DNA that was capable of transformation. If proteases (enzymes that degrade proteins) or ribonucleases (enzymes that degrade RNA) were added prior to the experiment, transformation could still occur. What did these treatments tell the investigators about the molecular identity of the transforming factor?

Explain why the melting temperature of a sample of doublehelical DNA increases when the \(\mathrm{Na}^{+}\)concentration increases.

A segment of the coding strand of a gene is shown below. ACACCATGGTGCATCTGACT a. Write the sequence of the complementary strand that DNA polymerase would make. b. Write the sequence of the mRNA that RNA polymerase would make from the gene segment.

A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCT- 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGA- GCTGACGCTGCTCGTCG-3 CGACTGCGACGAGCAGC-5 The sequence of the mRNA transcribed from this gene has the following sequence: 5 -AUGAUUCGCCUCGGGGCUCCCCAGUCGCUG- GUGCUGCUGACGCUGCUCGUCG-3 a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.