/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Essential Biochemistry Chapter 3 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 2

In 1944 , Avery, MacLeod, and McCarty set out to identify the chemical agent capable of transforming mutant unencapsulated Pneumococcus to the deadly encapsulated form (see Problem 1). They isolated a viscous substance with the chemical and physical properties of DNA that was capable of transformation. If proteases (enzymes that degrade proteins) or ribonucleases (enzymes that degrade RNA) were added prior to the experiment, transformation could still occur. What did these treatments tell the investigators about the molecular identity of the transforming factor?

Problem 19

Do Chargaft's rules hold true for RNA? Explain why or why not.

Problem 23

Explain whether the following statement is true or false: Because a G:C base pair is stabilized by three hydrogen bonds, whereas an A:T base pair is stabilized by only two hydrogen bonds, GC-rich DNA is harder to melt than AT- rich DNA.

Problem 30

Explain why the melting temperature of a sample of doublehelical DNA increases when the \(\mathrm{Na}^{+}\)concentration increases.

Problem 35

A segment of the coding strand of a gene is shown below. ACACCATGGTGCATCTGACT a. Write the sequence of the complementary strand that DNA polymerase would make. b. Write the sequence of the mRNA that RNA polymerase would make from the gene segment.

Problem 36

A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCT- 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGA- GCTGACGCTGCTCGTCG-3 CGACTGCGACGAGCAGC-5 The sequence of the mRNA transcribed from this gene has the following sequence: 5 -AUGAUUCGCCUCGGGGCUCCCCAGUCGCUG- GUGCUGCUGACGCUGCUCGUCG-3 a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

Problem 43

A mutation occurs when there is a base change in the DNA sequence. Some base changes do not lead to changes in the amino acid sequence of the resulting protein. Explain why.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks