/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 35 A segment of the coding strand o... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A segment of the coding strand of a gene is shown below. ACACCATGGTGCATCTGACT a. Write the sequence of the complementary strand that DNA polymerase would make. b. Write the sequence of the mRNA that RNA polymerase would make from the gene segment.

Short Answer

Expert verified
a. TGTGGTACCACGTAGACTGA; b. ACACCAUGGUGCAUCUGACU.

Step by step solution

01

Understanding the DNA Complement

DNA consists of two strands that are complementary to each other. When constructing the complementary strand, remember that Adenine (A) pairs with Thymine (T) and Cytosine (C) pairs with Guanine (G). Therefore, the complementary strand to the sequence ACACCATGGTGCATCTGACT is formed by converting each base to its complement: A ↔ T, C ↔ G.
02

Building the Complementary DNA Strand

Apply the pairing rules to each nucleotide in the original sequence ACACCATGGTGCATCTGACT to create the complementary strand. This results in: TGTGGTACCACGTAGACTGA.
03

Transcribing to mRNA

Transcription is the process where the DNA sequence is converted into mRNA. In mRNA, Adenine (A) pairs with Uracil (U) instead of Thymine (T). Using the coding strand ACACCATGGTGCATCTGACT directly (since mRNA is complementary to the template strand, thus matching the coding strand except U replaces T), change T to U to produce the mRNA sequence.
04

Constructing the mRNA Sequence

Convert the DNA coding sequence ACACCATGGTGCATCTGACT into mRNA by substituting each Thymine (T) with Uracil (U). This results in the mRNA sequence: ACACCAUGGUGCAUCUGACU.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Complementary DNA Strand
The DNA double helix is composed of two strands that complement each other. Each strand adheres to strict base pairing rules. When considering the sequence of a strand of DNA, it is important to know what defines the complementary strand. Each base on one strand pairs with a specific base on the opposite strand. This is facilitated by hydrogen bonds between the bases.

For DNA:
  • Adenine (A) pairs with Thymine (T)
  • Cytosine (C) pairs with Guanine (G)
To construct the complementary strand from a given DNA sequence, you simply replace each base with its complement. This specific arrangement ensures the stability of the double helix structure and plays a crucial role in DNA replication, where the entire genetic information can be precisely copied.
mRNA Synthesis
The process of transcribing a DNA sequence into messenger RNA (mRNA) is known as mRNA synthesis. This is a key step in expressing the information stored in the DNA. When an mRNA molecule is synthesized, it is essentially a copy of a specific section of DNA, intended for protein production.

During transcription, RNA polymerase reads the DNA template strand, constructing an mRNA strand by following base pairing rules. Importantly, the mRNA is complementary to the template DNA strand, thereby bearing almost exact resemblance to the coding strand of DNA, though with one critical difference:
  • Uracil (U) replaces Thymine (T) in RNA.
This RNA sequence now carries the genetic message from the DNA out of the nucleus to be translated into a protein in the cytoplasm.
Base Pairing Rules
Base pairing rules are fundamental to the structure and function of DNA and RNA. These rules dictate how nucleotides on one strand of DNA or RNA pair with nucleotides on the complementary strand.

In DNA, Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G). This mutual attraction between bases is crucial for maintaining the characteristics of the double helix.

During mRNA synthesis, the same principle applies, but with one notable modification:
  • Adenine (A) pairs with Uracil (U) instead of Thymine (T) when forming RNA.
These base pairing rules not only allow for the reliable storage and replication of genetic information but also ensure accuracy in the transcription and translation processes necessary for protein synthesis.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.