/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Essential Biochemistry Chapter 3 - (Page 3) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 37

. In the early 1960 s, Marshall Nirenberg deciphered the genetic code by designing an experiment in which he synthesized a polynucleotide strand consisting solely of U residues, then added this strand to a test tube containing all of the components needed for protein synthesis. a. What polypeptide was produced by this "cell-free" system? b. What polypeptides were produced when poly \(A\), poly \(C\), and poly \(\mathrm{G}\) were added to the cell-free system?

Problem 39

How many different codons are possible in nucleic acids containing four different nucleotides if a codon consisted of a. a single nucleotide, or consecutive sequences of b. two nucleotides, \(c\). three nucleotides, or d. four nucleotides? Does your answer help explain why codons consist of three nucleotides?

Problem 40

Synthetic biologists at the Scripps Institute expanded the genetic repertoire by adding two new bases into living bacterial cells. The two bases are named d5SICS and \(\mathrm{dNaM}\), and they base-pair with one another. How many different codons are possible in nucleic acids containing six different nucleotides if a codon consists of a consecutive sequence of three nucleotides?

Problem 41

An open reading frame (ORF) is a portion of the genome that potentially codes for a protein. A given mRNA nucleotide sequence potentially has three different reading frames, only one of which is correct (the selection of the correct ORF will be discussed more fully in Section 22.3). A portion of the gene for a type II human collagen is shown. a. What are the sequences of amino acids that can potentially be translated from each of the three possible reading frames? b. Collagen's amino acid sequence consists of repeating triplets in which every third amino acid is glycine. Does this information assist you in your identification of the correct reading frame? AGGTCTTCAGGGAATGCCTGGCGAGAGGGGAGCAGCTG- GTATCGCTGGGCCCAAAGGC

Problem 42

a. One form of the disease adrenoleukodystrophy (ALD) is caused by the substitution of serine for asparagine in the ALD protein. List the possible single-nucleotide alterations in the DNA of the ALD gene that could cause this genetic disease. b. In another form of ALD, a CGA codon is converted to a UGA codon. Explain how this mutation affects the ALD protein.

Problem 43

A mutation occurs when there is a base change in the DNA sequence. Some base changes do not lead to changes in the amino acid sequence of the resulting protein. Explain why.

Problem 44

Is it possible for the same segment of DNA to encode two different proteins? Explain.

Problem 50

. In theory, both strands of DNA can code for proteins; that is, genes can be overlapping. Propose an explanation for why overlapping genes are more commonly observed in prokaryotes than in eukaryotes.

Problem 51

For many years, biologists and others have claimed that humans and chimpanzees are \(98 \%\) identical at the level of DNA. Both the human and chimp genomes, which are roughly the same size, have now been sequenced, and the data reveal approximately 35 million nucleotide differences between the two species. How does this number compare to the original claim?

Problem 52

When genomes of various organisms were sequenced, biologists expected that the DNA content (the C-value) would always be positively correlated with organismal complexity. But no such correlation has been demonstrated. In fact, some plant and algae genomes are many times the size of the human genome. The C-value paradox is the term that refers to this puzzling lack of correlation between DNA content and organismal complexity. What questions do biologists need to ask as they attempt to solve the paradox?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks