/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 24 Hydrogen bonding does not make a... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Hydrogen bonding does not make a significantly large contribution to the overall stability of the DNA molecule. Explain.

Short Answer

Expert verified
Hydrogen bonds provide base pairing specificity, but overall DNA stability is mainly due to other interactions.

Step by step solution

01

Understanding Hydrogen Bonding in DNA

Hydrogen bonds are weak interactions that occur between specific nitrogenous bases in DNA: adenine pairs with thymine via two hydrogen bonds, and cytosine pairs with guanine via three hydrogen bonds. This bonding contributes to the correct base pairing in the DNA double helix structure.
02

Evaluating Bond Strength

Hydrogen bonds are much weaker than covalent bonds, which hold together the DNA backbone, including the sugar-phosphate bonds. Therefore, these weaker bonds among the base pairs are not the primary source of DNA's structural integrity.
03

Role of Other Interactions

The overall stability of the DNA molecule is mainly due to hydrophobic interactions, base stacking, and the sugar-phosphate backbone, which provide essential structural support and stability. These interactions are much stronger compared to hydrogen bonds.
04

Concluding Observations

While hydrogen bonds are crucial for the specificity of base pairing, they do not contribute significantly to the overall stability of DNA. This stability is largely due to hydrophobic interactions and the sugar-phosphate backbone.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Hydrogen Bonding
In the DNA structure, hydrogen bonding plays a crucial role in the pairing of nitrogenous bases. These bonds occur between the hydrogen atom of one base and the nitrogen or oxygen of another. This is a selective process, as adenine pairs with thymine through two hydrogen bonds, while cytosine pairs with guanine through three hydrogen bonds.
While these bonds are essential for the accurate pairings of bases, they are relatively weak compared to other forces within DNA. They aid in holding the two strands of DNA together but do not significantly contribute to the molecule's overall stability.
The reason lies in their nature; hydrogen bonds are easily broken under physical stress or environmental changes like heat. Therefore, although they are vital for maintaining the correct base pairing, they do not largely influence DNA's robustness.
Base Pairing
Base pairing is a fundamental concept in DNA structure, dictated by the rules of complementary base pairing. Adenine always pairs with thymine, and cytosine pairs with guanine. This pattern is due to the ability of these bases to form hydrogen bonds with each other.
The pairing is highly specific, ensuring genetic information is accurately copied and transmitted during cell division. This specificity is due to the size of the bases and the number of hydrogen bonds they can form.
Besides ensuring genetic fidelity, base pairing also plays a part in DNA's double-helix structure. However, the strength of these interactions isn't strong enough to solely account for the stability of the DNA; other forces are at play for that.
Covalent Bonds
Covalent bonds in DNA are some of the strongest and play an indispensable role in the molecule's integrity. They are responsible for linking nucleotides together, forming the backbone of the DNA structure. Each nucleotide is composed of a sugar, a phosphate group, and a base.
The covalent bonds occur between the sugar of one nucleotide and the phosphate of the next, creating the sugar-phosphate backbone. These bonds are much stronger than hydrogen bonds and provide significant structural stability to DNA.
Due to their strength, these covalent bonds ensure that the DNA remains intact even under conditions that might break weaker hydrogen bonds. This makes them crucial for maintaining the overall stability of DNA.
Hydrophobic Interactions
Hydrophobic interactions are less known but play a significant role in the stability of DNA. These interactions occur between the stacked bases, which are hydrophobic in nature.
The bases tend to avoid water and thus pack closely together, minimizing their exposure to the aqueous environment of the cell. This close stacking of bases creates a force known as base stacking interactions, which contributes substantially to the stability of the DNA double helix.
These interactions are a key reason why DNA can maintain its structure under various conditions, often much more than hydrogen bonds alone.
Sugar-Phosphate Backbone
The sugar-phosphate backbone is the key structural component of DNA that runs along the outside of the double helix. This backbone consists of alternating sugar and phosphate groups held together by covalent bonds.
It is highly stable, providing a framework that supports the positioning of the nitrogenous bases inside the helix. The integrity of the sugar-phosphate backbone is crucial for preserving the DNA molecule's overall structure.
Unlike the nitrogenous bases, the backbone is strongly resistant to breaking. This quality enables DNA to withstand mechanical strains and extreme environmental conditions, contributing significantly to its stability.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

For many years, biologists and others have claimed that humans and chimpanzees are \(98 \%\) identical at the level of DNA. Both the human and chimp genomes, which are roughly the same size, have now been sequenced, and the data reveal approximately 35 million nucleotide differences between the two species. How does this number compare to the original claim?

Do Chargaft's rules hold true for RNA? Explain why or why not.

Synthetic biologists at the Scripps Institute expanded the genetic repertoire by adding two new bases into living bacterial cells. The two bases are named d5SICS and \(\mathrm{dNaM}\), and they base-pair with one another. How many different codons are possible in nucleic acids containing six different nucleotides if a codon consists of a consecutive sequence of three nucleotides?

An open reading frame (ORF) is a portion of the genome that potentially codes for a protein. A given mRNA nucleotide sequence potentially has three different reading frames, only one of which is correct (the selection of the correct ORF will be discussed more fully in Section 22.3). A portion of the gene for a type II human collagen is shown. a. What are the sequences of amino acids that can potentially be translated from each of the three possible reading frames? b. Collagen's amino acid sequence consists of repeating triplets in which every third amino acid is glycine. Does this information assist you in your identification of the correct reading frame? AGGTCTTCAGGGAATGCCTGGCGAGAGGGGAGCAGCTG- GTATCGCTGGGCCCAAAGGC

A diploid organism with a 30,000 -kb haploid genome contains \(19 \%\) T residues. Calculate the number of \(\mathrm{A}, \mathrm{C}, \mathrm{G}\), and \(\mathrm{T}\) residues in the DNA of each cell in this organism.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.