/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 29 What might you find in comparing... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What might you find in comparing the GC content of DNA from Thermus aquaticus or Pyrococcus furiosus and DNA from bacteria in a typical backyard pond?

Short Answer

Expert verified
Thermophilic bacteria have higher GC content than pond bacteria due to adaptation to heat.

Step by step solution

01

Understanding GC Content

GC content refers to the percentage of guanine (G) and cytosine (C) bases in a DNA molecule. These bases form three hydrogen bonds with each other while adenine (A) and thymine (T) bases form only two hydrogen bonds, making GC base pairs more thermally stable.
02

Consider Environmental Adaptations

Both Thermus aquaticus and Pyrococcus furiosus are thermophilic organisms, thriving in high-temperature environments such as hot springs and hydrothermal vents. These extreme conditions often require DNA with higher thermal stability.
03

Comparing GC Content

DNA from thermophilic organisms like Thermus aquaticus and Pyrococcus furiosus typically has a higher GC content compared to DNA from bacteria found in typical backyard ponds. The higher GC content contributes to greater thermal stability of the DNA in high-temperature environments.
04

Conclusion of Differences

Bacteria in backyard ponds, which do not need to survive extreme temperatures, often have lower GC content as their DNA does not require such thermal stability. Thus, comparing GC content reflects the adaptation of DNA to environmental conditions.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Thermophilic Organisms
Thermophilic organisms are fascinating creatures that have adapted to live in extremely hot environments. These environments include hot springs, hydrothermal vents, and other geothermal-rich locations. These organisms are able to survive and thrive at temperatures that would normally denature proteins and nucleic acids in most other life forms.

Thermophilic organisms have several adaptations that enable them to maintain cellular function under such high temperatures:
  • They possess enzymes that are stable and active at high temperatures. These enzymes often have more robust structures with more intermolecular interactions that prevent unfolding.
  • Their cellular membranes may have unique lipid compositions that maintain fluidity and function despite the heat.
  • An important factor in their survival is the stability of their DNA, which directly relates to GC content.
Understanding the adaptations of thermophilic organisms can help scientists develop industrial enzymes that function under extreme conditions, benefiting various biotechnological applications.
DNA Thermal Stability
DNA thermal stability is an essential element for organisms living under extreme conditions, guiding their survival in hot environments. Thermal stability is largely influenced by the DNA's nucleotide composition, particularly the percentage of guanine (G) and cytosine (C) bases.

Here's why GC content contributes to thermal stability:
  • Hydrogen Bonding: G and C pair via three hydrogen bonds, compared to the two hydrogen bonds connecting adenine (A) and thymine (T). This makes GC pairs stronger and more resistant to heat-induced denaturation.
  • Stacking Interactions: GC pairs allow for better stacking interactions due to their planar nature, reinforcing the overall DNA structure.
These properties mean that DNA with higher GC content can withstand higher temperatures without losing its functional form. This is why organisms that live in high-temperature environments often have DNA with a higher GC content.
Environmental Adaptation
Environmental adaptation is a process through which organisms adjust to changes in their habitat or to different ecological niches. For organisms like bacteria, this can mean adapting to vast ranges of environmental conditions, from the extreme heat of geothermal vents to the milder climates of backyard ponds.

In the context of DNA, adaptation often involves changes in GC content as a means of enhancing thermal stability. This is because:
  • Higher GC content is advantageous in hot environments as it prevents DNA denaturation.
  • In cooler environments, high GC content is not as critical, allowing for a lower GC proportion.
Thus, comparing the GC content in organisms from different environments can give us insights into their evolutionary adaptations. Environmental adaptation demonstrates how genetic features are fine-tuned to improve an organism’s chances of survival across varied climatic conditions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Which is more likely to be called a "rare cutter". a restriction enzyme with a four-base recognition sequence or a restriction enzyme with an eight-base recognition sequence?

An open reading frame (ORF) is a portion of the genome that potentially codes for a protein. A given mRNA nucleotide sequence potentially has three different reading frames, only one of which is correct (the selection of the correct ORF will be discussed more fully in Section 22.3). A portion of the gene for a type II human collagen is shown. a. What are the sequences of amino acids that can potentially be translated from each of the three possible reading frames? b. Collagen's amino acid sequence consists of repeating triplets in which every third amino acid is glycine. Does this information assist you in your identification of the correct reading frame? AGGTCTTCAGGGAATGCCTGGCGAGAGGGGAGCAGCTG- GTATCGCTGGGCCCAAAGGC

a. Would you expect proteins to bind to the major groove or the minor groove of DNA? Explain. b. Eukaryotic DNA is packaged with histones, small proteins with a high lysine and arginine content. Why do histones have a high affinity for DNA?

Synthetic biologists at the Scripps Institute expanded the genetic repertoire by adding two new bases into living bacterial cells. The two bases are named d5SICS and \(\mathrm{dNaM}\), and they base-pair with one another. How many different codons are possible in nucleic acids containing six different nucleotides if a codon consists of a consecutive sequence of three nucleotides?

Discuss the shortcomings of the following definitions for gene: a. A gene is the information that determines an inherited characteristic such as flower color. b. A gene is a segment of DNA that encodes a protein. c. A gene is a segment of DNA that is transcribed in all cells.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.