/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 31 a. You have a short piece of syn... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

a. You have a short piece of synthetic RNA that you want to use as a probe to identify a gene in a sample of DNA. The RNA probe has a tendency to hybridize with sequences that are only weakly complementary. Should you increase or decrease the temperature to improve your chances of tagging the correct sequence? b. You have a short piece of single-stranded DNA that you want to hybridize to another strand of DNA with one mismatched base pair between the two strands. Should you increase or decrease the temperature to improve your chances of annealing the two strands?

Short Answer

Expert verified
a. Increase the temperature for RNA hybridization. b. Decrease the temperature for DNA annealing with mismatches.

Step by step solution

01

Understanding Hybridization

Hybridization occurs when nucleic acids such as DNA or RNA form complementary base pairs with another sequence. This ability is exploited in techniques like using RNA probes to identify genes. Complementarity is key for strong hybridization.
02

RNA Probe Hybridization

Given that the RNA probe hybridizes with only weak complementarity, we need the RNA and target DNA to bind stably to identify the gene accurately. By increasing the temperature, weaker, non-specific hybridizations are destabilized, while stronger, specific ones remain intact.
03

RNA Probe Temperature Decision

To ensure the RNA probe hybridizes correctly with the DNA target, increase the temperature. This ensures specificity by preventing weak, non-specific hybridization.
04

Understanding DNA Annealing

Annealing refers to two strands of DNA binding together through hydrogen bonds between complementary bases. In the presence of mismatches, like the one noted in the DNA strands, the stability of the DNA-DNA hybridization is affected.
05

DNA Annealing with Mismatch

Mismatches between DNA strands reduce the stability of the hybrid formed. Decreasing the temperature helps promote annealing despite mismatches, as it allows more time for the strands to align and bind with some degree of stability.
06

DNA Annealing Temperature Decision

To encourage annealing of DNA strands with a mismatch, decrease the temperature. This slows down the reaction and provides time for non-perfect complementary strands to bind.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA Probe
RNA probes are powerful tools often used in molecular biology to locate and identify specific DNA sequences in a sample. An RNA probe is essentially a small piece of RNA designed to be complementary to the DNA sequence of interest. This complementary nature is crucial because, for hybridization—the process of binding between the RNA probe and the target DNA—to occur effectively, the sequences need to match closely.
The match between the RNA probe and the DNA can range from perfect to imperfect. In cases where there is a weak complementarity, as mentioned in the exercise, not all hybridizations may be specific. To improve specificity and ensure the RNA probe binds correctly to its target DNA, one strategy is to increase the temperature during hybridization:
  • High temperatures can help break weak, non-specific interactions between the RNA probe and any non-target DNA.
  • This leaves only the strong, complementary binding intact.
Increasing the temperature, therefore, enhances the accuracy of identifying the correct DNA sequence with an RNA probe, by eliminating weaker bonds with non-target sequences.
DNA Annealing
DNA annealing refers to the process of two single-stranded DNA molecules binding through hydrogen bonds to form a double-stranded structure. This process is fundamental in various molecular biology methods, including PCR and DNA sequencing.
In typical situations, the DNA strands involved in annealing are fully complementary. However, sometimes mismatches occur, where there is a slight discrepancy between the bases, leading to less stable hybridization.
To encourage the annealing of DNA strands that don't match perfectly, adjusting the temperature is a key factor. By decreasing the temperature:
  • The process slows down, allowing the strands more opportunity to find and align with each other, despite the presence of mismatched bases.
  • This slower process results in more stable hybrid formations, as temporary dissociation can re-align properly paired regions while maintaining hydrogen bonds.
In summary, lowering the temperature aids in the annealing of imperfectly matched DNA pairs, encouraging the formation of a stable double-stranded structure, even if there are mismatches.
Temperature Effect on Hybridization
Temperature is a crucial factor influencing the hybridization process of nucleic acids. Hybridization is a balance between temperature, ionic conditions, and the sequences involved.
When adjusting the temperature during hybridization:
  • Increasing the temperature can help destabilize weak, non-specific interactions. Only strong, specific matches remain stable at higher temperatures, improving specificity.
  • Decreasing the temperature allows time for nucleic acid strands, even with mismatches, to slowly align and bond. This is particularly useful when dealing with non-perfect complements.
Hence, selecting the right temperature is critical for achieving the desired hybridization specificity and stability. Whether you are using RNA probes or encouraging DNA annealing with mismatches, understanding how temperature influences these processes is essential. Carefully managed, temperature can be manipulated to fine-tune the specificity and stability of nucleic acid interactions, leading to successful hybridization outcomes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCT- 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGA- GCTGACGCTGCTCGTCG-3 CGACTGCGACGAGCAGC-5 The sequence of the mRNA transcribed from this gene has the following sequence: 5 -AUGAUUCGCCUCGGGGCUCCCCAGUCGCUG- GUGCUGCUGACGCUGCUCGUCG-3 a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

In certain pathogenic bacteria, the methylation of certain adenines in DNA is required in order for the bacteria to cause disease. a. Draw the structure of \(N^{6}\)-methyladenine. b. Why might scientists be interested in studying the bacterial enzyme \(N^{6}\)-DNA methyltransferase, which catalyzes the transfer of methyl groups to adenine?

Hydrogen bonding does not make a significantly large contribution to the overall stability of the DNA molecule. Explain.

An open reading frame (ORF) is a portion of the genome that potentially codes for a protein. A given mRNA nucleotide sequence potentially has three different reading frames, only one of which is correct (the selection of the correct ORF will be discussed more fully in Section 22.3). A portion of the gene for a type II human collagen is shown. a. What are the sequences of amino acids that can potentially be translated from each of the three possible reading frames? b. Collagen's amino acid sequence consists of repeating triplets in which every third amino acid is glycine. Does this information assist you in your identification of the correct reading frame? AGGTCTTCAGGGAATGCCTGGCGAGAGGGGAGCAGCTG- GTATCGCTGGGCCCAAAGGC

A mutation occurs when there is a base change in the DNA sequence. Some base changes do not lead to changes in the amino acid sequence of the resulting protein. Explain why.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.