/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Introduction to Genetic Analysis Chapter 14 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 22

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read 3: CTATCCGGGCGAACTTTTGGCCG Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

Problem 23

Sometimes, cDNAs turn out to be "monsters"; that is, fusions of DNA copies of two different mRNAs accidentally inserted adjacently to each other in the same clone. You suspect that a cDNA clone from the nematode Caenorhabditis elegans is such a monster because the sequence of the cDNA insert predicts a protein with two structural domains not normally observed in the same protein. How would you use the availability of the entire genomic sequence to assess if this cDNA clone is a monster or not?

Problem 25

In browsing through the chimpanzee genome, you find that it has three homologs of a particular gene, whereas humans have only two. a. What are two alternative explanations for this observation? b. How could you distinguish between these two possibilities?

Problem 27

You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analy- sis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli When you compare nucleotide sequences of the S. typhimurium and \(E\) coli genes, you find that their nucleotide sequences are only 87 percent identical. a. Explain this observation. b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?

Problem 28

To inactivate a gene by RNAi, what information do you need? Do you need the map position of the target gene?

Problem 31

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H .\) sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http://www.ncbi. nlm.nih.gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

Problem 33

Some exons in the human genome are quite small (less than 75 bp long. Identification of such "microexons" is difficult because these distances are too short to reliably use ORF identification or codon bias to determine if small genomic sequences are truly part of an mRNA and a polypeptide. What techniques of "gene finding" can be used to try to assess if a given region of 75 bp constitutes an exon?

Problem 34

You are studying proteins having roles in translation in the mouse. By BLAST analysis of the predicted proteins of the mouse genome, you identify a set of mouse genes that encode proteins with sequences similar to those of known eukaryotic translation-initiation factors. You are interested in determining the phenotypes associated with loss-of-function mutations of these genes. a. Would you use forward- or reverse-genetics approaches to identify these mutations? b. Briefly outline two different approaches that you might use to look for loss-of-function phenotypes in one of these genes.

Problem 35

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URFs). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks