/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Introduction to Genetic Analysis Chapter 15 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 10

Explain how the properties of \(P\) elements in Drosophila make gene-transfer experiments possible in this organism.

Problem 12

As you saw in Figure \(15-22,\) the genes of multicellular eukaryotes often contain many transposable elements. Why do most of these elements not affect the expression of the gene?

Problem 14

Nobel prizes are usually awarded many years after the actual discovery. For example, James Watson, Francis Crick, and Maurice Wilkens were awarded the Nobel Prize in Medicine or Physiology in \(1962,\) almost a decade after their discovery of the double-helical structure of DNA. However, Barbara McClintock was awarded the Nobel Prize in \(1983,\) almost four decades after her discovery of transposable elements in maize. Why do you think it took this long?

Problem 15

The insertion of transposable elements into genes can alter the normal pattern of expression. In the following situations, describe the possible consequences on gene expression. a. A LINE inserts into an enhancer of a human gene. b. A transposable element contains a binding site for a transcriptional repressor and inserts adjacent to a promoter. c. \(\operatorname{An} A l u\) element inserts into the \(3^{\prime}\) splice (AG) site of an intron. d. \(A D s\) element that was inserted into the exon of a gene excises imperfectly and leaves 3 base pairs behind in the exon. e. Another excision by that same \(D\) s element leaves 2 base pairs behind in the exon. f. \(A D s\) element that was inserted into the middle of an intron excises imperfectly and leaves 5 base pairs behind in the intron.

Problem 16

Before the integration of a transposon, its transposase makes a staggered cut in the host target DNA. If the staggered cut is at the sites of the arrows below, draw what the sequence of the host DNA will be after the transposon has been inserted. Represent the transposon as a rectangle. AATTTGGCCTAGTACTAATTGGTTGG TTAAACCGGATCATGATTAACCAACC

Problem 17

In Drosophila, M. Green found a singed allele \((\mathrm{sn})\) with some unusual characteristics. Females homozygous for this X-linked allele have singed bristles, but they have numerous patches of \(s n^{+}(\text {wild-type })\) bristles on their heads, thoraxes, and abdomens. When these flies are mated with \(s n\) males, some females give only singed progeny, but others give both singed and wild-type progeny in variable proportions. Explain these results.

Problem 19

You meet your friend, a scientist, at the gym and she begins telling you about a mouse gene that she is studying in the lab. The product of this gene is an enzyme required to make the fur brown. The gene is called \(F B\) and the enzyme is called FB enzyme. When \(F B\) is mutant and cannot produce the FB enzyme, the fur is white. The scientist tells you that she has isolated the gene from two mice with brown fur and that, surprisingly, she found that the two genes differ by the presence of a 250 -bp SINE (like the human \(A l u\) element) in the \(F B\) gene of one mouse but not in the gene of the other. She does not understand how this difference is possible, especially given that she determined that both mice make the FB enzyme. Can you help her formulate a hypothesis that explains why the mouse can still produce FB enzyme with a transposable element in its \(F B\) gene?

Problem 20

The yeast genome has class 1 elements \((T y 1, T y 2,\) and so forth) but no class 2 elements. Can you think of a possible reason why DNA elements have not been successful in the yeast genome?

Problem 22

Based on the mechanism of gene silencing, what features of transposable elements does the RNAi pathway exploit to ensure that the host's own genes are not also silenced?

Problem 26

Of all the genes in the human genome, the ones with the most characterized \(A l u\) insertions are those that cause hemophilia, including several insertions in the factor VIII and factor IX genes. Based on this fact, your colleague hypothesizes that the \(A l u\) element prefers to insert into these genes. Do you agree? What other reason can you provide that also explains these data?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks