/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 34 You are studying proteins having... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

You are studying proteins having roles in translation in the mouse. By BLAST analysis of the predicted proteins of the mouse genome, you identify a set of mouse genes that encode proteins with sequences similar to those of known eukaryotic translation-initiation factors. You are interested in determining the phenotypes associated with loss-of-function mutations of these genes. a. Would you use forward- or reverse-genetics approaches to identify these mutations? b. Briefly outline two different approaches that you might use to look for loss-of-function phenotypes in one of these genes.

Short Answer

Expert verified
Use reverse genetics to identify mutations. Try gene knockout or RNA interference to study loss-of-function phenotypes.

Step by step solution

01

Understanding Forward vs. Reverse Genetics

Forward genetics involves starting with a phenotype and then identifying the gene responsible, while reverse genetics starts with a gene and assesses the phenotype resulting from its disruption. Since you have identified a set of mouse genes and are interested in their loss-of-function phenotypes, reverse genetics is the suitable approach.
02

Approach 1 - Gene Knockout

A common method in reverse genetics is gene knockout. This involves creating a mouse model in which one or more of your identified genes are inactivated or 'knocked out.' You accomplish this by using techniques such as CRISPR-Cas9 to introduce deletions or mutations in the gene sequence. Observing the resulting phenotype in knockout mice helps you determine the role of each gene.
03

Approach 2 - RNA Interference (RNAi)

Another reverse genetics approach is RNA interference. By using small interfering RNA (siRNA) molecules that are complementary to the mRNA of the target gene, you can effectively silence or 'knock down' gene expression. This partial loss-of-function allows you to study the phenotype caused by reduced activity of the gene without a complete knockout.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Translation-Initiation Factors
Translation-initiation factors play a crucial role in the beginning stages of protein synthesis. These factors are proteins that assist in the assembly of the ribosome on the mRNA strand, facilitating the start of translation by promoting the joining of ribosomal subunits. This process is critical for ensuring that the ribosome can accurately read the mRNA and translate it into a functional protein. By interacting with ribosomal RNA and other initiation factors, they ensure the whole process is efficient and precise.
Translation-initiation factors can be classified into various categories based on their specific functions, such as:
  • Recognition of the mRNA cap structure
  • Facilitating the ribosome's binding to mRNA
  • Assisting the scanning of mRNA to locate the start codon
These activities are essential for the correct initiation of protein synthesis, and any mutations can lead to protein synthesis errors, which could have significant biological consequences.
Loss-of-Function Mutations
Loss-of-function mutations are changes in the gene sequence that result in reduced or eliminated activity of the encoded protein. These mutations can be caused by various genetic alterations, including deletions, insertions, or point mutations that impair the protein's functionality. When studying mouse models, researchers often seek to understand the phenotypic consequences of these mutations to determine the specific role of a gene.
There are several reasons why a mutation might result in a loss of function:
  • The mutation might directly alter the active site of an enzyme or affect its binding with other molecules.
  • It could lead to the production of a truncated or misfolded protein that is non-functional.
  • The mutation might disrupt the regulation of gene expression, affecting the protein's availability.
Understanding these mutations is particularly beneficial in reverse genetics, as it allows researchers to infer the function of a gene based on the phenotype observed in its absence.
Gene Knockout
Gene knockout is a powerful technique used in reverse genetics to investigate the function of specific genes. In this approach, researchers deliberately inactivate or "knock out" a gene to analyze the resulting phenotype. Tools like CRISPR-Cas9 have revolutionized this process, allowing precise editing of the genome by introducing targeted deletions or mutations.
Knockout studies typically follow several steps:
  • Selecting a target gene based on its suspected role or similarity to known factors.
  • Designing a CRISPR guide RNA to specifically target the gene.
  • Introducing the CRISPR components into cells to create the knockout.
  • Breeding and studying animal models with the knockout gene to observe phenotype changes.
Such studies are fundamental in understanding gene function, particularly in cases where the loss of a gene produces significant or interesting phenotypic changes.
RNA Interference
RNA interference (RNAi) is an essential tool in functional genomics, employed to "silence" or diminish the expression of specific genes. Unlike gene knockout, RNAi does not remove a gene but reduces its activity to study its effects. This is particularly useful in situations where a complete loss might be lethal or cause severe abnormalities.
The process involves a few key steps:
  • Synthesizing small interfering RNA (siRNA) that matches the target gene's mRNA.
  • Introducing these siRNAs into cells where they bind to their corresponding mRNA.
  • The siRNA-mRNA complex is then recognized and degraded by cellular machinery, preventing protein translation.
  • Researchers then examine the phenotypic changes that arise from this reduced expression.
RNAi is a versatile technique that allows for the temporary suppression of gene function, making it invaluable for studying genes where complete knockout is not possible or practical.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H .\) sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http://www.ncbi. nlm.nih.gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URFs). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read 3: CTATCCGGGCGAACTTTTGGCCG Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

In a two-hybrid test, a certain gene \(A\) gave positive results with two clones, \(M\) and \(N\). When \(M\) was used, it gave positives with three clones, \(A, S,\) and \(Q .\) Clone \(N\) gave only one positive (with A). Develop a tentative interpretation of these results.

You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analy- sis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli When you compare nucleotide sequences of the S. typhimurium and \(E\) coli genes, you find that their nucleotide sequences are only 87 percent identical. a. Explain this observation. b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.