/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 31 You have the following sequence ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H .\) sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http://www.ncbi. nlm.nih.gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

Short Answer

Expert verified
a) The contig sequence is TGTCTGCCATTCTTAAAAACAAAAATGTTGTTATTTTTATTTCAGATGCGATCTGTGAGCCGAGTCTTTA. b) Translate this contig into six reading frames. c) Perform BLASTp with translated sequences to identify gene matches.

Step by step solution

01

Identify Overlapping Regions

Start by identifying overlapping regions between the reads to assemble them into a contiguous sequence (contig). From the given data, note the overlaps: - Read 3 (TTCAGATGCGATCTGTGAGCCGAG) overlaps with Read 1 (ATGCGATCTGTGAGCCGAGTCTTTA) at 'GCGATCTGTGAGCCGAG'. - Read 5 (TGTTATTTTTATTTCAGATGCGA) overlaps with Read 3 (TTCAGATGCGATCTGTGAGCCGAG) at 'TTCAGATGCGA'. - Read 2 (AACAAAAATGTTGTTATTTTTATTTCAGATG) overlaps with Read 5 (TGTTATTTTTATTTCAGATGCGA) at 'TGTTATTTTTATTTCAGATG'. - Read 4 (TGTCTGCCATTCTTAAAAACAAAAATGT) overlaps with Read 2 (AACAAAAATGTTGTTATTTTTATTTCAGATG) at 'AAAAACAAAAATGT'. - Read 6 (AACAAAAATGTTGTTATT) overlaps with Read 4 at 'AACAAAAATGT'. The best fit for Read 6 does not extend longer than visible overlaps, better omit paired inclusion as it doesn't contribute longer or same sequence found. Arrange and connect these sequences using overlaps.
02

Assemble Overlaps into a Contig

Based on the overlaps identified, construct the contig sequence: - Start with the longest overlapping chain and stitch according to their matching parts: - Read 4 connects to Read 2 at 'AAAAACAAAAATGT': TGTCTGCCATTCTTAAAAACAAAAATGTTGTTATTTTTATTTCAGATG - Next, Read 5 overlaps with Read 2 directly: TGTTGTTATTTTTATTTCAGATGCGATCTGTGAGCCGAG - Integrate Read 3 and Read 1 via GCGATCTGTGAGCCGAG resulting into the same overlap but long reads alignment being the base: TTCAGATGCGATCTGTGAGCCGAGTCTTTA Therefore the full contig is: TGTCTGCCATTCTTAAAAACAAAAATGTTGTTATTTTTATTTCAGATGCGATCTGTGAGCCGAGTCTTTA.
03

Translate Sequence in All Reading Frames

Translate the contig sequence into possible reading frames. DNA can be translated into protein in six possible frames: 3 forward and 3 reverse. 1. **First forward frame**: - Start translation from the first base: TGTCTGCCATTCTT.. - Incorrectly arranged DNA segments might form incomplete codons or stop *---* codons. 2. **Second forward frame**: - Start translation from the second base: GTCTGCCATTCTTA.. - Translated length doesn't suffice, indicating shifting was necessary. 3. **Third forward frame**: - Start translation from the third base: TCTGCCATTCTTAA.. - Again, profiling a likely stop indication further adjusts the translation length. Translation software or services can assist further with accuracy, but typically distorted structures surmise incorrect consolidation. **Reverse frames** are derived similarly from the reverse complement of sequence given above. Use tools for accurate derivations until further decoding frames can sequence Translation Enterprise is performed.
04

Perform BLASTp Search

Submit each of the translated peptide sequences from Step 3 as queries to the BLASTp (Protein-Protein BLAST) database at NCBI. Analyze the search results for each frame to see if any frame matches a known protein in the database. Check the alignment scores, identities, and possible annotations to identify any gene affiliations.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Sequence Assembly
Sequence assembly is one of the critical steps in genomics that involves merging short DNA fragments (reads) into longer continuous sequences (contigs). This process is essential to recreate the entire genome from numerous small pieces obtained through sequencing technologies.
Sequence assembly begins with identifying overlapping regions between the DNA reads. These overlaps indicate that those pieces share some common sequences, suggesting they originate from adjacent parts of the genome.
  • Overlap detection: Scientists first look for sequences that partially match at the ends of the reads.
  • Reconstruction: Once overlaps are found, the reads are assembled by aligning and merging them into larger sequences.
This process can be likened to solving a jigsaw puzzle where each piece is connected based on overlapping edges. Assembling these overlapping reads correctly results in a more accurate representation of the target genomic region.
DNA Translation
DNA translation is the process by which a messenger RNA (mRNA) sequence is decoded into a sequence of amino acids. This is the second step of the Central Dogma of Molecular Biology, which involves transcription, translation, and protein synthesis.
DNA sequences can be translated into protein using six potential reading frames — three in the forward direction and three in the reverse. The reading frames refer to the three possible ways to read the nucleotide triplets (codons) due to the triplet nature of codon sequences.
  • Forward frames (1st, 2nd, 3rd): Read from the start codon on the 5'->3' direction.
  • Reverse frames (4th, 5th, 6th): Derived from the reverse complement of the DNA sequence.
Misreading or skipping bases can lead to frame shifts, causing incorrect proteins to form. This underscores the importance of correct sequence alignment and translation frame identification, especially where precise protein synthesis is critical.
BLASTp Analysis
BLASTp (Basic Local Alignment Search Tool for proteins) is a bioinformatics tool designed for comparing an amino acid sequence (protein sequence) query against a protein database. This tool helps researchers identify potential similarities between a newly sequenced protein and existing known proteins, which can reveal functional, structural, or evolutionary relationships.
To perform a BLASTp analysis, sequence data from the translation of a genomic contig is submitted as a query to the NCBI BLAST database. The process evaluates sequence similarities and returns results indicating the degree of match to known proteins.
  • Query Submission: Translational products from the contig are entered into the BLAST system.
  • Alignment Scoring: The tool provides scores that gauge the alignment quality between the query and database sequences.
  • Interpretation: Results highlight possible gene functions, evolutionary lineage, or relevance in biochemical pathways.
Utilizing BLASTp can be crucial for identifying unknown genes, understanding gene function, and exploring potential biological roles within the organism.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analy- sis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli When you compare nucleotide sequences of the S. typhimurium and \(E\) coli genes, you find that their nucleotide sequences are only 87 percent identical. a. Explain this observation. b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?

A segment of cloned DNA containing a protein-encoding gene is radioactively labeled and used in an in situ hybridization to chromosomes. Radioactivity was observed over five regions on different chromosomes. How is this result possible?

Some exons in the human genome are quite small (less than 75 bp long. Identification of such "microexons" is difficult because these distances are too short to reliably use ORF identification or codon bias to determine if small genomic sequences are truly part of an mRNA and a polypeptide. What techniques of "gene finding" can be used to try to assess if a given region of 75 bp constitutes an exon?

The word contig is derived from the word contiguous. Explain the derivation.

In a genomic analysis looking for a specific disease gene, one candidate gene was found to have a single-base-pair substitution resulting in a nonsynonymous amino acid change. What would you have to check before concluding that you had identified the disease-causing gene?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.