/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 28 To inactivate a gene by RNAi, wh... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

To inactivate a gene by RNAi, what information do you need? Do you need the map position of the target gene?

Short Answer

Expert verified
You need the gene's mRNA sequence, not the map position, to design RNAi.

Step by step solution

01

Understanding RNAi

RNA interference (RNAi) is a biological process in which RNA molecules inhibit gene expression by neutralizing targeted mRNA molecules. To inactivate a gene using RNAi, you introduce a double-stranded RNA (dsRNA) that is complementary to the mRNA of the gene you want to silence.
02

Assessing Required Information

To design an effective RNAi construct, you need the sequence information of the gene's mRNA. This allows you to synthesize dsRNA or a small interfering RNA (siRNA) that will bind specifically to the mRNA of the target gene and trigger its degradation.
03

Evaluating Map Position

The map position of the gene—the exact location of the gene on the chromosome—is not necessary for RNAi. What is crucial is having enough sequence data to design the RNAi molecule that will match the gene's mRNA, as this will determine the effectiveness of gene silencing.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Gene Silencing
Gene silencing is an essential process in genetics, allowing scientists to "turn off" or reduce the expression of specific genes. This technique is especially valuable in research and medicine because it helps to understand the function of genes and treat diseases linked to gene expression. Gene silencing occurs predominantly through RNA interference (RNAi), where double-stranded RNA (dsRNA) molecules are used to target messenger RNA (mRNA) of the gene intended for silencing. The process is akin to putting a lock on a gene's message, preventing it from being read and enacted by the cell. Here is how it works:
  • Introduction: A dsRNA molecule complementary to the mRNA of the gene is introduced into the cell.
  • Cleavage: The dsRNA is processed into small interfering RNAs (siRNAs) by cellular machinery.
  • Binding: The siRNAs then pair with the target mRNA, marking it for destruction.
  • Degradation: This complex is recognized by the cell, and the target mRNA is degraded, leading to gene silencing.
By understanding and manipulating gene silencing, researchers can study gene function and develop therapeutic strategies.
mRNA Sequence
The mRNA sequence of a gene carries the critical "blueprint" that instructs cells to produce proteins. In RNA interference, having accurate information about the mRNA sequence of the target gene is paramount for effective gene silencing. This sequence determines where the RNA interference machinery will act. Reading mRNA is like reading a code in biology. The bases—adenine (A), uracil (U), cytosine (C), and guanine (G)—are the letters of this code. Each sequence or combination of these letters spells out the instructions to make proteins. Here's why the mRNA sequence is crucial for RNAi:
  • Synthesis: Knowing the mRNA sequence allows for the design and synthesis of complementary dsRNA or siRNA that will bind precisely to the target.
  • Specificity: The sequence ensures that the RNAi process targets just the intended mRNA, reducing off-target effects.
  • Effectiveness: Accurate sequence matching means the gene silencing is efficient and impactful, as the interference only occurs with the complementary mRNA.
This precise targeting is what makes RNA interference such a powerful tool in genetic research and medicine.
dsRNA Design
Designing dsRNA for RNA interference is like crafting the perfect key to unlock a specific lock—in this case, the lock being the mRNA for silencing. The process requires precision and careful planning. Here are the fundamental steps and considerations in dsRNA design:
  • Sequence Alignment: Start by aligning your dsRNA sequence with the mRNA of the target gene to ensure maximum complementarity and binding specificity.
  • Length and Structure: Typically, dsRNA is designed to be about 20-25 nucleotides long, the optimal length for inducing RNAi without triggering unintended cellular responses.
  • Stability: The dsRNA must be stable enough to enter the cell and reach the mRNA target without degrading prematurely.
  • Minimizing Off-target Effects: Choose unique segments of the target mRNA to reduce unintended interactions with non-target mRNAs.
Successful dsRNA design leads to efficient gene silencing, making it a cornerstone of RNAi applications in genetic studies and therapeutic innovations.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

You are studying proteins having roles in translation in the mouse. By BLAST analysis of the predicted proteins of the mouse genome, you identify a set of mouse genes that encode proteins with sequences similar to those of known eukaryotic translation-initiation factors. You are interested in determining the phenotypes associated with loss-of-function mutations of these genes. a. Would you use forward- or reverse-genetics approaches to identify these mutations? b. Briefly outline two different approaches that you might use to look for loss-of-function phenotypes in one of these genes.

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URFs). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read 3: CTATCCGGGCGAACTTTTGGCCG Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

Is a bacterial operator a binding site?

In a genomic analysis looking for a specific disease gene, one candidate gene was found to have a single-base-pair substitution resulting in a nonsynonymous amino acid change. What would you have to check before concluding that you had identified the disease-causing gene?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.