/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 22 You have the following sequence ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read 3: CTATCCGGGCGAACTTTTGGCCG Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

Short Answer

Expert verified
TTGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA is the constructed contig.

Step by step solution

01

Identify Overlaps

Examine each pair of reads to identify overlaps. An overlap occurs when the end of one read matches the start of another. For example, Read 4 (CGTGATGGGCAGTTCCGGTG) overlaps significantly with Read 1 (TGGCCGTGATGGGCAGTTCCGGTG) because it contains the entire sequence except the initial part, which aligns with the end of Read 5.
02

Determine the Order of Reads

Once overlaps are found, determine the correct order of reads using these overlaps. For instance, Read 5 (TTGGCCGTGATGGGCAGTT) leads into Read 1, which leads into Read 2. Similarly, Read 1 aligns with Read 4 and Read 6.
03

Construct the Sequence Contig

Begin by placing Read 5, then align Read 1 with it to extend the sequence. Continue to add overlapping reads in the order identified in Step 2. The overlap ensures the correct sequence without repetition. Ensure each read seamlessly integrates into a growing contig.
04

Verify Sequence Integrity

Check the completed contig against each read to ensure that all parts are included and correctly ordered. The final sequence should not have any missing regions or misalignments compared to the reads.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Drosophila melanogaster
Drosophila melanogaster, commonly known as the fruit fly, is a model organism widely used in genetic research. This little insect has a genome that is useful for scientific study because it is simpler than those of more complex organisms but still shares significant similarities with humans. It provides valuable insights into fundamental biological processes due to its genetic simplicity and the ease with which scientists can manipulate its genes. Understanding the genomic sequence of Drosophila melanogaster is vital as it helps in deciphering genetic relationships and functions that could be related to human genetics.
Sequence Overlap Analysis
Sequence overlap analysis involves examining genome sequence reads to identify areas where they share common segments. In genomic sequencing, reads are short fragments of a much longer DNA sequence. By finding overlapping sections between these reads, scientists can reconstruct the original sequence as it existed in the organism's genome. Let's imagine it like a puzzle, where each read is a piece, and checking overlaps helps to join these pieces together. Overlaps are crucial because they guide researchers in assembling sequences accurately, ensuring that no genetic information is lost in the process. The task of finding overlaps, as mentioned in the exercise, is instrumental in determining how different sequence reads relate to one another, helping in the construction of a contiguous sequence or contig.
Contig Construction
Contig construction is the process of piecing together overlapping sequence reads to form a continuous sequence known as a contig. This task requires identifying the correct order of reads based on their overlaps. Imagine having several strips of paper, each with a part of the story written on it. To make sense of the whole story, you need to overlap the strips in the correct order. Similarly, in creating a contig, we begin by aligning reads with the most overlap and systematically extend the sequence by adding subsequent reads based on matching sections. The overlapping reads assure that all genetic information is integrated, forming a precise sequence without gaps or redundancy. This construction is pivotal in producing a reliable representation of the organism's genome, necessary for further genetic analysis and research.
Sequence Verification
Sequence verification is a critical step in genomic sequence assembly. Once a contig is assembled from overlapping reads, it's essential to validate that the sequence correctly represents the original genetic material. Verification involves checking that each read is accounted for in the contig without any omissions or misalignments. Think of it as proofreading a document to ensure that nothing is missing and everything flows logically. During verification, discrepancies or errors in alignment are identified and rectified, providing confidence in the overall sequence integrity. This step ensures the accuracy of the sequence data, which is vital for any subsequent genetic interpretation or applications in scientific research.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.