/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 33 Some exons in the human genome a... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Some exons in the human genome are quite small (less than 75 bp long. Identification of such "microexons" is difficult because these distances are too short to reliably use ORF identification or codon bias to determine if small genomic sequences are truly part of an mRNA and a polypeptide. What techniques of "gene finding" can be used to try to assess if a given region of 75 bp constitutes an exon?

Short Answer

Expert verified
Techniques such as comparative genomics, RNA-Seq data analysis, splice site prediction tools, and machine learning models can help identify 75 bp exons.

Step by step solution

01

Understand Gene Finding

Gene finding is a process used to identify regions of genomic DNA that encode genes. This process is complicated for short sequences like 'microexons' (less than 75 bp) because traditional methods such as Open Reading Frame (ORF) detection and codon bias analysis, which work well for longer sequences, are less effective for these small sequences.
02

Use Comparative Genomics

This technique involves comparing genomic sequences from different species to identify conserved regions. If a 75 bp region is conserved across species, it is more likely to be functionally important and may be an exon. Comparative genomics takes advantage of the evolutionary pressure to preserve sequences that play critical roles.
03

Employ RNA-Seq Data Analysis

RNA sequencing (RNA-Seq) data provides information about mRNA transcripts directly from tissues. By analyzing RNA-Seq data, one can detect the presence of expressed sequences in the transcriptome. If the 75 bp region is expressed, it likely constitutes an exon. Aligning RNA-Seq reads to the genome can confirm whether the sequence is transcribed into RNA.
04

Use Splice Site Prediction Tools

These tools predict the presence of splice sites by examining the sequence features around potential intron-exon boundaries. For a 75 bp region to be an exon, it should be flanked by canonical splice sites, which can be detected using machine learning models trained on known exon-intron junctions.
05

Utilize Machine Learning Models

Machine learning models can analyze genomic data to identify exons based on pattern recognition. These models can be trained on large genomic datasets that include known exons and non-exons, allowing them to recognize subtle sequence features unique to exons, even very small ones like microexons.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Microexons
Microexons are tiny segments of DNA that are often less than 75 base pairs (bp) in length. These small exonic sequences pose a unique challenge in gene annotation due to their size. Their diminutive size makes traditional gene finding techniques, such as Open Reading Frame (ORF) detection and codon bias analysis, less effective.
Unveiling microexons requires alternative approaches because these methods rely on identifying patterns that are too small or subtle in microexons. Despite their size, microexons can play crucial roles in protein diversity and function. They are often involved in splicing events that can lead to the production of different protein isoforms, greatly influencing cellular functions.
Understanding microexons requires high-resolution tools and innovative methods in genomics. This is essential to ensure that these elusive segments are accurately identified and their roles within the genome are fully appreciated.
Comparative Genomics
Comparative genomics is a field that focuses on comparing the genomes of different species to find similarities and differences. This approach is particularly useful for identifying conserved elements across species, which may indicate functional importance.
When it comes to gene finding, comparative genomics can help confirm whether small sequences, like microexons, constitute genuine exons. By checking if a 75 bp sequence is conserved across multiple organisms, researchers can infer its significance.
Evolutionary conservation suggests that these sequences might perform critical biological roles, as natural selection tends to conserve functionally important DNA segments. With the rapid growth of genetic data from various species, comparative genomics has become an indispensable tool in uncovering the evolutionary history and functional elements within genomes.
RNA-Seq Analysis
RNA-Seq analysis is a modern technique that provides insights into the transcriptome, which is the full range of RNA molecules expressed by an organism. This method involves sequencing RNA in a tissue or cell type to determine which genes are active and at what levels.
For microexon detection, RNA-Seq can offer evidence of transcription and translation. By aligning RNA-Seq reads to the genomic DNA, researchers can ascertain if a given 75 bp region is expressed as part of an mRNA. If reads align with this region, it suggests that the sequence, despite its small size, functions as an exon.
RNA-Seq is invaluable in identifying new exons and clarifying ambiguities in genome annotations, thus supporting more accurate gene models and expanding our understanding of genetic complexity.
Splice Site Prediction
Splice site prediction focuses on identifying the boundaries where exons and introns meet in pre-mRNA. Accurate prediction of these sites is crucial for understanding how RNA molecules are spliced to create mature mRNA.
For microexons, splice site prediction models help to identify potential exon-intron junctions. These models analyze sequence patterns near expected splice sites using canonical signals and machine learning algorithms trained on known sequences.
Predicting splice sites around microexons ensures that these tiny exonic sequences are correctly annotated in the genome. This is vital for recognizing their potential functions and their role in alternative splicing, a process that contributes to protein diversity by allowing one gene to produce multiple proteins.
Machine Learning in Genomics
Machine learning in genomics involves using computational models to analyze large genomic datasets. These models can identify patterns that distinguish exonic sequences from non-exonic ones by learning from features in existing annotated genomes.
Such models are particularly useful for identifying microexons, which might not display obvious or easily detectable sequence characteristics. By training these algorithms on known examples, machine learning can recognize subtle differences in sequences that would otherwise be missed by human analysis or simpler computational tools.
Machine learning enhances our ability to predict features like splice sites or promoter regions, thereby improving gene annotations. As genomic data continues to expand, machine learning models will play an increasingly vital role in processing and interpreting this information, leading to deeper insights into how genes are regulated and expressed.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

You are studying proteins having roles in translation in the mouse. By BLAST analysis of the predicted proteins of the mouse genome, you identify a set of mouse genes that encode proteins with sequences similar to those of known eukaryotic translation-initiation factors. You are interested in determining the phenotypes associated with loss-of-function mutations of these genes. a. Would you use forward- or reverse-genetics approaches to identify these mutations? b. Briefly outline two different approaches that you might use to look for loss-of-function phenotypes in one of these genes.

A segment of cloned DNA containing a protein-encoding gene is radioactively labeled and used in an in situ hybridization to chromosomes. Radioactivity was observed over five regions on different chromosomes. How is this result possible?

The word contig is derived from the word contiguous. Explain the derivation.

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URFs). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H .\) sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http://www.ncbi. nlm.nih.gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.