/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 A segment of cloned DNA containi... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A segment of cloned DNA containing a protein-encoding gene is radioactively labeled and used in an in situ hybridization to chromosomes. Radioactivity was observed over five regions on different chromosomes. How is this result possible?

Short Answer

Expert verified
This result is due to homologous sequences, gene families, or gene duplications on different chromosomes.

Step by step solution

01

Understanding the Problem

The exercise involves identifying what it means for a radioactively labeled DNA segment to hybridize with five regions on different chromosomes during in situ hybridization. This occurs when a fragment of DNA can pair with sequences in multiple locations.
02

Explanation of Gene Homology

A likely reason for observing radioactivity over different chromosomes is the presence of homologous or similar sequences spread across various locations. Protein-encoding genes can have homologous sequences or repeated segments, allowing them to hybridize in multiple areas.
03

Considering Gene Families

Another reason could involve gene families. Genes sharing evolutionary origins, such as gene families, might have sequences that resemble each other, resulting in hybridization spread across different chromosomes.
04

Review of Pseudogenes or Duplications

It's possible that the original gene has pseudogenes or duplications in other chromosome segments. Pseudogenes are non-functional sequences of genomic DNA similar to normal genes, and duplications can cause gene copies to appear on different chromosomes.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

In Situ Hybridization
In situ hybridization is a powerful technique used in genetic analysis to detect the location of specific DNA or RNA sequences in chromosomes. This method involves creating a probe, a small piece of DNA or RNA, that is complementary to the sequence being studied. Researchers typically label this probe with a detectable marker, such as a fluorescent dye or a radioactive element.
  • The labeled probe is then introduced to the chromosomes.
  • It binds, or hybridizes, to any complementary sequences present.
This allows scientists to see exactly where the target sequences are located within the genome, often on specific chromosomes.
In situ hybridization is crucial for pinpointing genetic abnormalities, mapping gene locations, and studying gene expression patterns. Seeing radioactivity in multiple regions during in situ hybridization can suggest genetic phenomena such as duplications or homologous sequences spread across different chromosomes.
Gene Homology
Gene homology describes the relationship between genes that share a common ancestry. Similar or identical gene sequences can be found across different organisms or within different regions of an organism's genome. This genetic similarity can be due to two main types of homology: orthology and paralogy.
  • Orthologous genes are genes in different species that evolved from a common ancestral gene following a speciation event. They generally retain the same function across species.
  • Paralogous genes, on the other hand, arise from gene duplication events within the same organism. They can evolve new functions over time.
In genetic analysis, discovering regions of gene homology could explain why a DNA probe hybridizes to multiple locations in a chromosome, indicating the presence of similar sequences spread out across the genome.
Gene Families
Gene families consist of groups of related genes that likely evolved from a single ancestral gene. These genes share similar sequences and often have similar biological functions.
  • Gene families often result from gene duplication events, where copies of a gene are created and may acquire new functions over time.
  • These similar genes can appear in different parts of the genome, often on different chromosomes.
When radioactivity is observed in various regions during an analysis like in situ hybridization, it might suggest the presence of a gene family. This occurs because the probe can hybridize with different but related sequences in these widespread locations.
Pseudogenes
Pseudogenes are segments of DNA that resemble protein-coding genes but are generally non-functional. Despite their lack of function, they are a record of evolutionary history and can provide insight into past genetic events, such as duplications or mutations.
  • Pseudogenes can arise from either duplication of a gene or retrotransposition, where a reverse transcribed mRNA is inserted back into the genome.
  • Even though they don’t typically produce proteins, pseudogenes can play roles in gene regulation and evolution.
In genomic analyses, the presence of pseudogenes may explain hybridization patterns seen across multiple chromosome regions because a probe meant for a functional gene may also bind to its non-functional counterparts.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URFs). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

Explain the approach that you would apply to sequencing the genome of a newly discovered bacterial species.

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read 3: CTATCCGGGCGAACTTTTGGCCG Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

A sequenced fragment of DNA in Drosophila was used in a BLAST search. The best (closest) match was to a kinase gene from Neurospora. Does this match mean that the Drosophila sequence contains a kinase gene?

In a two-hybrid test, a certain gene \(A\) gave positive results with two clones, \(M\) and \(N\). When \(M\) was used, it gave positives with three clones, \(A, S,\) and \(Q .\) Clone \(N\) gave only one positive (with A). Develop a tentative interpretation of these results.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.