/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 In an in situ hybridization expe... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

In an in situ hybridization experiment, a certain clone bound to only the \(X\) chromosome in a boy with no disease symptoms. However, in a boy with Duchenne muscular dystrophy (X-linked recessive disease), it bound to the X chromosome and to an autosome. Explain. Could this clone be useful in isolating the gene for Duchenne muscular dystrophy?

Short Answer

Expert verified
The clone binds differently in affected vs. healthy boys, suggesting a chromosomal rearrangement linked to the disease. It could help in isolating the disease-related gene.

Step by step solution

01

Understand the Clones

In the experiment, the clone is expected to bind specifically to the X chromosome in healthy individuals. This means that the sequence of the clone matches a part of the X chromosome.
02

Analyze the Results in Healthy Boy

In a healthy boy with no disease symptoms, the clone binds only to the X chromosome, indicating that the sequence is normal and does not cause disease.
03

Evaluate the Results in Affected Boy

In a boy with Duchenne muscular dystrophy, the clone binds to the X chromosome and also to an autosome. This suggests there is a chromosomal rearrangement or duplication involving the autosome and the gene related to Duchenne muscular dystrophy.
04

Determine Link to Duchenne Muscular Dystrophy

The clone’s binding pattern in the affected boy indicates that there might be a chromosomal anomaly involving the gene for Duchenne muscular dystrophy, possibly providing a mechanism for the disease.
05

Assess Whether the Clone is Useful

Yes, the clone could be useful in isolating the gene for Duchenne muscular dystrophy if the sequence overlaps or is included in the region causing the disease, especially with its additional binding on an autosome.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

X-linked recessive disease
An X-linked recessive disease is a type of genetic disorder where the defective gene causing the disease is located on the X chromosome. Since males have only one X chromosome (inherited from their mother), a single recessive mutant gene is enough to cause the disease in males. This is why X-linked recessive diseases, such as Duchenne muscular dystrophy, primarily affect males.
Females, on the other hand, have two X chromosomes, so they are often carriers of the disease without showing symptoms. A female would need to have the recessive mutant gene on both of her X chromosomes to express the disorder, which is less common.
Key points to remember about X-linked recessive diseases include:
  • Males are more frequently affected than females.
  • A healthy mother can pass the disease on to her sons.
  • Affected fathers cannot pass the disease to their sons, but their daughters will be carriers.
chromosomal rearrangement
Chromosomal rearrangement refers to a change in the structure of a chromosome. This can involve deletions, duplications, inversions, or translocations of a chromosome segment. Such rearrangements can disrupt the function of genes and can lead to genetic disorders.
In the context of the exercise, when the clone binds to both the X chromosome and an autosome in the boy with Duchenne muscular dystrophy, it suggests a chromosomal rearrangement. This means that part of the X chromosome containing the Duchenne-related gene may be translocated to an autosome, potentially disrupting normal gene function.
Important aspects of chromosomal rearrangements include:
  • They can cause genes to be misplaced, leading to disorders.
  • They can be a cause for certain conditions where symptoms and inheritance don't follow neat patterns.
  • Detection often involves special laboratory techniques like karyotyping or in situ hybridization.
gene isolation
Gene isolation is a process used in genetics to find and extract a specific gene to study its structure and function. It is a critical step in understanding how genes contribute to traits and diseases.
In the problem given, the clone's binding pattern suggests that it could help in isolating the gene associated with Duchenne muscular dystrophy by targeting the specific sequence responsible for the disease. If this clone binds to a region involved in the chromosomal rearrangement, it provides a clue to scientists about where the Duchenne-related gene might be located.
Key elements of gene isolation are:
  • It involves identifying DNA sequences specific to a trait or disorder.
  • It can be done using techniques like PCR (Polymerase Chain Reaction) or in situ hybridization.
  • Successful isolation helps in developing targeted therapies and a deeper understanding of genetic diseases.
Duchenne muscular dystrophy
Duchenne muscular dystrophy (DMD) is a severe type of muscular dystrophy characterized by rapid progression of muscle degeneration, leading to difficulty walking, breathing problems, and a shortened lifespan. It is caused by mutations in the DMD gene on the X chromosome, which codes for dystrophin, a protein essential for muscle function.
In boys with DMD, the absence or defect of dystrophin causes muscle cells to be damaged easily upon contraction, which eventually leads to muscle weakness and destruction.
Key facets of Duchenne muscular dystrophy include:
  • It is an X-linked recessive disease, predominantly affecting males.
  • Symptoms typically begin between ages 2 and 5.
  • There is currently no cure, but treatments can improve quality of life and extend survival.
  • Research in gene therapy is ongoing to find a potential cure.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In browsing through the chimpanzee genome, you find that it has three homologs of a particular gene, whereas humans have only two. a. What are two alternative explanations for this observation? b. How could you distinguish between these two possibilities?

The word contig is derived from the word contiguous. Explain the derivation.

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read 3: CTATCCGGGCGAACTTTTGGCCG Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H .\) sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http://www.ncbi. nlm.nih.gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

A segment of cloned DNA containing a protein-encoding gene is radioactively labeled and used in an in situ hybridization to chromosomes. Radioactivity was observed over five regions on different chromosomes. How is this result possible?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.