/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 25 In browsing through the chimpanz... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

In browsing through the chimpanzee genome, you find that it has three homologs of a particular gene, whereas humans have only two. a. What are two alternative explanations for this observation? b. How could you distinguish between these two possibilities?

Short Answer

Expert verified
Chimpanzee gene duplication or human gene loss are possible explanations; distinguish using genomic and phylogenetic analysis.

Step by step solution

01

Understanding the Observation

The observation indicates that chimpanzees have three copies (homologs) of a specific gene, while humans only have two. This raises the question of why there is a difference in the number of gene copies between the two species.
02

Gene Duplication in Chimpanzees

One potential explanation is that after the evolutionary split between humans and chimpanzees, a gene duplication event occurred in the chimpanzee lineage. This means one of the original gene copies was duplicated again, resulting in three homologs in chimpanzees.
03

Gene Loss in Humans

An alternative explanation is that both humans and chimpanzees initially had three homologs after their common ancestor, but humans lost one gene due to deletion or mutation events over time, leaving them with two copies.
04

Distinguishing between Explanations

To determine which explanation is correct, one could compare the genomic regions of humans and chimpanzees. Sequencing the regions containing these genes and analyzing the phylogenetic history of the homologs would reveal whether a duplication event occurred in chimpanzees or a loss occurred in humans.
05

Phylogenetic Analysis

By constructing a phylogenetic tree with the gene sequences from both humans and chimpanzees, alongside sequences from related species, we can determine the evolutionary history. If all three chimpanzee genes cluster with one human gene, they result from duplication in chimpanzees. If two genes consistently group together with one missing in humans, it indicates a gene loss in humans.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Gene Duplication
Gene duplication is a fascinating process in which one or more copies of a gene are created. Unlike mutations that alter existing genetic sequences, gene duplication results in a whole new copy of a gene.
This can lead to new functions or enhanced gene product levels.
  • Duplicated genes are known as paralogs, which might undergo changes, leading to diversifications in functions.
  • These additional copies can evolve separately and take on entirely new roles or work together with the original gene to enhance an organism's adaptability.
Gene duplication is considered a significant driver of evolution as it opens new pathways for species to adapt to their environment.
It allows for genetic innovation without compromising the original gene's function.
Gene Loss
Gene loss corresponds to the process where a gene that once existed in a species' genome is either completely removed or rendered nonfunctional. This can occur due to several mechanisms such as deletion, mutation, or loss of gene function.
  • Over evolutionary time, some genes might become obsolete if they no longer serve an advantageous purpose.
  • This loss can result from mutations that disrupt the gene sequence or deletion events that completely remove the gene from the genome.
  • Sometimes, the environment changes or other genes may take over the original gene's function, leading to its loss.
Gene loss is often counterbalanced by gene duplication.
Understanding gene loss gives insights into why some species might have less genetic material than others and how they adapt to different environmental pressures.
Phylogenetic Analysis
Phylogenetic analysis is a method used to study the evolutionary relationships between species or genes.
By examining genetic material, scientists build a phylogenetic tree, similar to a family tree, to understand these connections.
  • A phylogenetic tree illustrates how closely related different species or genes are and infers their evolutionary paths.
  • These trees are constructed using computational methods that analyze gene sequences and compare them across species.
  • The placement of branches indicates how long ago species or genes diverged from each other.
In the context of gene duplication or loss, phylogenetic trees can pinpoint whether a gene was duplicated or lost in a particular lineage.
By comparing sequences from different species, scientists can determine the most likely evolutionary events that resulted in the current genomic arrangement.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The word contig is derived from the word contiguous. Explain the derivation.

Is a bacterial operator a binding site?

You are studying proteins having roles in translation in the mouse. By BLAST analysis of the predicted proteins of the mouse genome, you identify a set of mouse genes that encode proteins with sequences similar to those of known eukaryotic translation-initiation factors. You are interested in determining the phenotypes associated with loss-of-function mutations of these genes. a. Would you use forward- or reverse-genetics approaches to identify these mutations? b. Briefly outline two different approaches that you might use to look for loss-of-function phenotypes in one of these genes.

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H .\) sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (http://www.ncbi. nlm.nih.gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

In an in situ hybridization experiment, a certain clone bound to only the \(X\) chromosome in a boy with no disease symptoms. However, in a boy with Duchenne muscular dystrophy (X-linked recessive disease), it bound to the X chromosome and to an autosome. Explain. Could this clone be useful in isolating the gene for Duchenne muscular dystrophy?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.