/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 17 A tryptophan residue near the pe... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A tryptophan residue near the periphery of a proteinprotein interface is mutated to alanine and changes ti \(K_{\mathrm{D}}\) of binding from \(1 \mathrm{nM}\) to \(40 \mu \mathrm{M}\) at \(300 \mathrm{~K}\). a. How much binding energy was contributed by th: residue? b. Explain whether or not the tryptophan residue is likely a hot spot residue.

Short Answer

Expert verified
The residue contributed 21.83 kJ/mol. It's not a hot spot.

Step by step solution

01

Understand the Relationship between K_{D} and Binding Energy

The dissociation constant, \( K_{D} \), is related to the Gibbs free energy change (\( \Delta G \)) for the binding interaction through the equation: \[ \Delta G = RT \ln K_{D} \] where \( R \) is the universal gas constant \( 8.314 \frac{J}{mol \cdot K} \) and \( T \) is the temperature in Kelvin. A change in \( K_{D} \) indicates a change in binding energy due to mutation.
02

Calculate Initial Binding Energy ( \Delta G_{initial} )

Substitute \( K_{D} = 1 \text{ nM} = 1 \times 10^{-9} \text{ M} \) into the equation for \( \Delta G \):\[ \Delta G_{initial} = (8.314 \frac{J}{mol \cdot K}) \times 300 \text{ K} \times \ln(1 \times 10^{-9}) \]\[ \Delta G_{initial} = -52.18 \text{ kJ/mol} \] \This represents the binding energy before the mutation.
03

Calculate Final Binding Energy (\Delta G_{final})

For \( K_{D} = 40 \mu \text{M} = 40 \times 10^{-6} \text{ M} \):\[ \Delta G_{final} = (8.314 \frac{J}{mol \cdot K}) \times 300 \text{ K} \times \ln(40 \times 10^{-6}) \]\[ \Delta G_{final} = -30.35 \text{ kJ/mol} \]This energy indicates the binding after the mutation.
04

Calculate Change in Binding Energy due to Mutation ( \Delta \Delta G )

\( \Delta \Delta G \) is the difference between the initial and final \( \Delta G \):\[ \Delta \Delta G = \Delta G_{final} - \Delta G_{initial} = -30.35 \, \text{kJ/mol} - (-52.18 \, \text{kJ/mol}) \]\[ \Delta \Delta G = 21.83 \, \text{kJ/mol} \]This value represents the binding energy contributed by the tryptophan residue.
05

Evaluate if Tryptophan is a Hotspot

A hotspot residue typically contributes a binding energy change of \( \Delta \Delta G \leq -2.0 \, \text{kcal/mol} \) or \(-8.4 \, \text{kJ/mol} \). Here, \( \Delta \Delta G = 21.83 \, \text{kJ/mol} \), indicating the mutation significantly increases \( K_{D} \). Therefore, tryptophan is not contributing enough binding energy to be considered a hot spot.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Binding Energy
Binding energy is the energy required to separate two molecules that are bound together, such as protein-protein interactions. It is a crucial measure of the strength of an interaction.
The higher the binding energy, the stronger the interaction and vice versa. In biochemical contexts, binding energy is often expressed as Gibbs free energy change (\( \Delta G \)).
  • Gibbs free energy (\( \Delta G \)) indicates whether a process will occur spontaneously.
  • For binding interactions, a negative \( \Delta G \) value suggests favorable binding conditions, signifying a stable and strong interaction.
The expression \( \Delta G = RT \,\ln{K_{D}} \) links binding energy to the dissociation constant \( K_{D} \), where \( R \) is the gas constant and \( T \) is temperature. Therefore, changes in \( K_{D} \) reflect shifts in binding energy, which can be due to alterations like mutations in a protein.
Dissociation Constant
The dissociation constant, \( K_{D} \), is a vital concept in understanding binding interactions. It measures the affinity between two molecules, such as proteins.
A lower \( K_{D} \) indicates a higher affinity, meaning the molecules bind more strongly together. Conversely, a higher \( K_{D} \) means a weaker binding interaction.
  • Changes in \( K_{D} \) reflect how mutations or changes in conditions can affect binding affinity, impacting biological processes.
  • A small \( K_{D} \) suggests tightly bound molecules, seen frequently in critical biological functions like enzyme-substrate interactions.
In our example, the mutation increased the \( K_{D} \) from 1 nM to 40 µM, indicating a substantial decrease in binding affinity. This shift shows how a single residue can greatly influence overall protein-protein interactions.
Hotspot Residues
In the context of protein interactions, hotspot residues are specific amino acids that contribute disproportionately to the binding energy. These residues often play an essential role in maintaining binding affinity and specificity.
Identifying hotspot residues is crucial for drug design and protein engineering. Such residues typically have \( \Delta \Delta G \leq -2.0 \, \text{kcal/mol} \) (or \(-8.4 \, \text{kJ/mol} \)).
  • Hotspots help understand protein interactions and identify targets for therapeutics.
  • They usually form key interfaces in protein-protein interactions, holding the structures tightly together.
In the exercise, the change due to mutation shows \( \Delta \Delta G = 21.83 \, \text{kJ/mol} \), indicating the tryptophan residue does not function as a hotspot. This is evidenced by the significant loss in binding affinity after mutation, demonstrating its non-critical role in maintaining the interaction.
Gibbs Free Energy
Gibbs free energy is a thermodynamic potential that helps predict the direction of chemical reactions and the stability of interactions, such as protein bindings. It integrates enthalpy, temperature, and entropy to define a system's capacity to do work.
In binding interactions, Gibbs free energy change (\( \Delta G \)) specifies how spontaneous a process will be.
  • A negative \( \Delta G \) suggests a reaction occurs spontaneously and has a strong, favorable interaction.
  • For positive \( \Delta G \), the reaction is non-spontaneous, indicating weak or unfavorable interactions.
In binding contexts, such as discussed in this solution, Gibbs free energy is related closely to \( K_{D} \), essentially quantifying the affinity and strength of interaction. Calculating \( \Delta G \) before and after mutations helps assess the impact of specific residues on protein interactions, as demonstrated by the exercise's assessment of a mutated tryptophan residue.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Interface residues that do not contribute greatly to binding affinity are also generally unimportant for specificity. True/False

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

Which of the following is an attribute of the FGF-FGFR family of interactions? a. Each FGF ligand has high specificity for an FGF receptor. b. Because there are \(18 \mathrm{FGF}\) and \(4 \mathrm{FGFR}\) genes, there are 72 potential interactions. c. Signaling specificity is enhanced through selective expression of only a few receptors per tissue type. d. FGFRs are soluble serine/threonine kinases. e. FGF proteins have highly diverse folds.

A complex of seven transcription factors binds a DNA enhancer element. The binding is cooperative. What are two molecular mechanisms that the transcription factors might use to achieve this cooperativity?

A protein-protein interface comprises 22 residues at the contact surface. From structures of the isolated proteins, it is expected that completely burying these residues would cause a surface area reduction of \(\sim 2000 \AA^{2}\). However, a structure of the interface reveals that only \(1200 \AA^{2}\) of surface area is buried. Why is there a discrepancy between the expected and measured surface area reductions?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.